Mock Version: 5.2 Mock Version: 5.2 Mock Version: 5.2 ENTER ['do_with_status'](['bash', '--login', '-c', '/usr/bin/rpmbuild -bs --noclean --target riscv64 --nodeps /builddir/build/SPECS/bowtie.spec'], chrootPath='/var/lib/mock/f40-build-2274835-55029/root'env={'TERM': 'vt100', 'SHELL': '/bin/bash', 'HOME': '/builddir', 'HOSTNAME': 'mock', 'PATH': '/usr/bin:/bin:/usr/sbin:/sbin', 'PROMPT_COMMAND': 'printf "\\033]0;\\007"', 'PS1': ' \\s-\\v\\$ ', 'LANG': 'C.UTF-8'}shell=Falselogger=timeout=864000uid=997gid=135user='mockbuild'nspawn_args=[]unshare_net=TrueprintOutput=False) Executing command: ['bash', '--login', '-c', '/usr/bin/rpmbuild -bs --noclean --target riscv64 --nodeps /builddir/build/SPECS/bowtie.spec'] with env {'TERM': 'vt100', 'SHELL': '/bin/bash', 'HOME': '/builddir', 'HOSTNAME': 'mock', 'PATH': '/usr/bin:/bin:/usr/sbin:/sbin', 'PROMPT_COMMAND': 'printf "\\033]0;\\007"', 'PS1': ' \\s-\\v\\$ ', 'LANG': 'C.UTF-8'} and shell False Building target platforms: riscv64 Building for target riscv64 setting SOURCE_DATE_EPOCH=1705622400 Wrote: /builddir/build/SRPMS/bowtie-1.3.1-3.fc40.src.rpm Child return code was: 0 ENTER ['do_with_status'](['bash', '--login', '-c', '/usr/bin/rpmbuild -bb --noclean --target riscv64 --nodeps /builddir/build/SPECS/bowtie.spec'], chrootPath='/var/lib/mock/f40-build-2274835-55029/root'env={'TERM': 'vt100', 'SHELL': '/bin/bash', 'HOME': '/builddir', 'HOSTNAME': 'mock', 'PATH': '/usr/bin:/bin:/usr/sbin:/sbin', 'PROMPT_COMMAND': 'printf "\\033]0;\\007"', 'PS1': ' \\s-\\v\\$ ', 'LANG': 'C.UTF-8'}shell=Falselogger=timeout=864000uid=997gid=135user='mockbuild'nspawn_args=[]unshare_net=TrueprintOutput=False) Executing command: ['bash', '--login', '-c', '/usr/bin/rpmbuild -bb --noclean --target riscv64 --nodeps /builddir/build/SPECS/bowtie.spec'] with env {'TERM': 'vt100', 'SHELL': '/bin/bash', 'HOME': '/builddir', 'HOSTNAME': 'mock', 'PATH': '/usr/bin:/bin:/usr/sbin:/sbin', 'PROMPT_COMMAND': 'printf "\\033]0;\\007"', 'PS1': ' \\s-\\v\\$ ', 'LANG': 'C.UTF-8'} and shell False Building target platforms: riscv64 Building for target riscv64 setting SOURCE_DATE_EPOCH=1705622400 Executing(%prep): /bin/sh -e /var/tmp/rpm-tmp.eOtNlG + umask 022 + cd /builddir/build/BUILD + cd /builddir/build/BUILD + rm -rf bowtie-1.3.1-src + /usr/lib/rpm/rpmuncompress -x /builddir/build/SOURCES/bowtie-1.3.1-src.zip + STATUS=0 + '[' 0 -ne 0 ']' + cd bowtie-1.3.1-src + rm -rf /builddir/build/BUILD/bowtie-1.3.1-src-SPECPARTS + /usr/bin/mkdir -p /builddir/build/BUILD/bowtie-1.3.1-src-SPECPARTS + /usr/bin/chmod -Rf a+rX,u+w,g-w,o-w . + rm -rf third_party/ ++ find . -name '*.py' + for file in $(find . -name "*.py") bowtie bowtie-* + sed -E -i '1s|/usr/bin/env python[3]?|/usr/bin/python3|' bowtie + for file in $(find . -name "*.py") bowtie bowtie-* + sed -E -i '1s|/usr/bin/env python[3]?|/usr/bin/python3|' bowtie-build + for file in $(find . -name "*.py") bowtie bowtie-* + sed -E -i '1s|/usr/bin/env python[3]?|/usr/bin/python3|' bowtie-inspect + RPM_EC=0 ++ jobs -p + exit 0 Executing(%build): /bin/sh -e /var/tmp/rpm-tmp.0EsDCZ + umask 022 + cd /builddir/build/BUILD + CFLAGS='-O2 -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Werror=implicit-function-declaration -Werror=implicit-int -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -Wp,-D_GLIBCXX_ASSERTIONS -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -fasynchronous-unwind-tables -fno-omit-frame-pointer ' + export CFLAGS + CXXFLAGS='-O2 -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -Wp,-D_GLIBCXX_ASSERTIONS -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -fasynchronous-unwind-tables -fno-omit-frame-pointer ' + export CXXFLAGS + FFLAGS='-O2 -fexceptions -g -grecord-gcc-switches -pipe -Wall -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -Wp,-D_GLIBCXX_ASSERTIONS -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -fasynchronous-unwind-tables -fno-omit-frame-pointer -I/usr/lib64/gfortran/modules ' + export FFLAGS + FCFLAGS='-O2 -fexceptions -g -grecord-gcc-switches -pipe -Wall -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -Wp,-D_GLIBCXX_ASSERTIONS -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -fasynchronous-unwind-tables -fno-omit-frame-pointer -I/usr/lib64/gfortran/modules ' + export FCFLAGS + VALAFLAGS=-g + export VALAFLAGS + RUSTFLAGS='-Copt-level=3 -Cdebuginfo=2 -Ccodegen-units=1 -Cstrip=none -Cforce-frame-pointers=yes -Clink-arg=-Wl,-z,relro -Clink-arg=-Wl,-z,now -Clink-arg=-specs=/usr/lib/rpm/redhat/redhat-package-notes --cap-lints=warn' + export RUSTFLAGS + LDFLAGS='-Wl,-z,relro -Wl,--as-needed -Wl,-z,now -specs=/usr/lib/rpm/redhat/redhat-hardened-ld -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -Wl,--build-id=sha1 -specs=/usr/lib/rpm/redhat/redhat-package-notes ' + export LDFLAGS + LT_SYS_LIBRARY_PATH=/usr/lib64: + export LT_SYS_LIBRARY_PATH + CC=gcc + export CC + CXX=g++ + export CXX + cd bowtie-1.3.1-src + export POPCNT_CAPABILITY=0 + POPCNT_CAPABILITY=0 ++ echo '-O2 -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Werror=implicit-function-declaration -Werror=implicit-int -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -Wp,-D_GLIBCXX_ASSERTIONS -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -fasynchronous-unwind-tables -fno-omit-frame-pointer ' ++ sed -e s/-Wp,-D_GLIBCXX_ASSERTIONS// + CFLAGS='-O2 -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Werror=implicit-function-declaration -Werror=implicit-int -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -fasynchronous-unwind-tables -fno-omit-frame-pointer ' + export CFLAGS ++ echo '-O2 -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -Wp,-D_GLIBCXX_ASSERTIONS -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -fasynchronous-unwind-tables -fno-omit-frame-pointer ' ++ sed -e s/-Wp,-D_GLIBCXX_ASSERTIONS// + CXXFLAGS='-O2 -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -fasynchronous-unwind-tables -fno-omit-frame-pointer ' + export CXXFLAGS + /usr/bin/make -O -j64 V=1 VERBOSE=1 allall EXTRA_FLAGS=-g g++ -O0 -g3 \ -DCOMPILER_OPTIONS="\"-O0 -g3 -g -Wl,--hash-style=both -O2 -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Werror=implicit-function-declaration -Werror=implicit-int -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -fasynchronous-unwind-tables -fno-omit-frame-pointer -O2 -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -fasynchronous-unwind-tables -fno-omit-frame-pointer \"" -g -Wl,--hash-style=both -O2 -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Werror=implicit-function-declaration -Werror=implicit-int -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -fasynchronous-unwind-tables -fno-omit-frame-pointer -O2 -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -fasynchronous-unwind-tables -fno-omit-frame-pointer \ -fno-strict-aliasing -DBOWTIE_VERSION="\"`cat VERSION`\"" -DBUILD_HOST="\"reproduciblebuild\"" -DBUILD_TIME="\"2024-01-19T00:00:00\"" -DCOMPILER_VERSION="\"`g++ -v 2>&1 | tail -1`\"" -D_LARGEFILE_SOURCE -D_FILE_OFFSET_BITS=64 -D_GNU_SOURCE -DPREFETCH_LOCALITY=2 -DBOWTIE_MM -DBOWTIE_SHARED_MEM -DBOWTIE_64BIT_INDEX -Wall -Wno-unused-parameter -Wno-reorder \ -I third_party -I . \ -o bowtie-inspect-l-debug bowtie_inspect.cpp \ ccnt_lut.cpp ref_read.cpp alphabet.cpp shmem.cpp edit.cpp ebwt.cpp bt2_locks.cpp tinythread.cpp \ -Wl,-z,relro -Wl,--as-needed -Wl,-z,now -specs=/usr/lib/rpm/redhat/redhat-hardened-ld -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -Wl,--build-id=sha1 -specs=/usr/lib/rpm/redhat/redhat-package-notes -lz -lpthread cc1plus: warning: ‘-Werror=’ argument ‘-Werror=implicit-function-declaration’ is not valid for C++ cc1plus: warning: ‘-Werror=’ argument ‘-Werror=implicit-int’ is not valid for C++ cc1plus: warning: ‘-Werror=’ argument ‘-Werror=implicit-function-declaration’ is not valid for C++ cc1plus: warning: ‘-Werror=’ argument ‘-Werror=implicit-int’ is not valid for C++ cc1plus: warning: ‘-Werror=’ argument ‘-Werror=implicit-function-declaration’ is not valid for C++ cc1plus: warning: ‘-Werror=’ argument ‘-Werror=implicit-int’ is not valid for C++ cc1plus: warning: ‘-Werror=’ argument ‘-Werror=implicit-function-declaration’ is not valid for C++ cc1plus: warning: ‘-Werror=’ argument ‘-Werror=implicit-int’ is not valid for C++ cc1plus: warning: ‘-Werror=’ argument ‘-Werror=implicit-function-declaration’ is not valid for C++ cc1plus: warning: ‘-Werror=’ argument ‘-Werror=implicit-int’ is not valid for C++ cc1plus: warning: ‘-Werror=’ argument ‘-Werror=implicit-function-declaration’ is not valid for C++ cc1plus: warning: ‘-Werror=’ argument ‘-Werror=implicit-int’ is not valid for C++ cc1plus: warning: ‘-Werror=’ argument ‘-Werror=implicit-function-declaration’ is not valid for C++ cc1plus: warning: ‘-Werror=’ argument ‘-Werror=implicit-int’ is not valid for C++ cc1plus: warning: ‘-Werror=’ argument ‘-Werror=implicit-function-declaration’ is not valid for C++ cc1plus: warning: ‘-Werror=’ argument ‘-Werror=implicit-int’ is not valid for C++ cc1plus: warning: ‘-Werror=’ argument ‘-Werror=implicit-function-declaration’ is not valid for C++ cc1plus: warning: ‘-Werror=’ argument ‘-Werror=implicit-int’ is not valid for C++ g++ -O0 -g3 \ -DCOMPILER_OPTIONS="\"-O0 -g3 -g -Wl,--hash-style=both -O2 -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Werror=implicit-function-declaration -Werror=implicit-int -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -fasynchronous-unwind-tables -fno-omit-frame-pointer -O2 -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -fasynchronous-unwind-tables -fno-omit-frame-pointer \"" -g -Wl,--hash-style=both -O2 -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Werror=implicit-function-declaration -Werror=implicit-int -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -fasynchronous-unwind-tables -fno-omit-frame-pointer -O2 -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -fasynchronous-unwind-tables -fno-omit-frame-pointer \ -fno-strict-aliasing -DBOWTIE_VERSION="\"`cat VERSION`\"" -DBUILD_HOST="\"reproduciblebuild\"" -DBUILD_TIME="\"2024-01-19T00:00:00\"" -DCOMPILER_VERSION="\"`g++ -v 2>&1 | tail -1`\"" -D_LARGEFILE_SOURCE -D_FILE_OFFSET_BITS=64 -D_GNU_SOURCE -DPREFETCH_LOCALITY=2 -DBOWTIE_MM -DBOWTIE_SHARED_MEM -Wall -Wno-unused-parameter -Wno-reorder \ -I third_party -I . \ -o bowtie-inspect-s-debug bowtie_inspect.cpp \ ccnt_lut.cpp ref_read.cpp alphabet.cpp shmem.cpp edit.cpp ebwt.cpp bt2_locks.cpp tinythread.cpp \ -Wl,-z,relro -Wl,--as-needed -Wl,-z,now -specs=/usr/lib/rpm/redhat/redhat-hardened-ld -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -Wl,--build-id=sha1 -specs=/usr/lib/rpm/redhat/redhat-package-notes -lz -lpthread cc1plus: warning: ‘-Werror=’ argument ‘-Werror=implicit-function-declaration’ is not valid for C++ cc1plus: warning: ‘-Werror=’ argument ‘-Werror=implicit-int’ is not valid for C++ cc1plus: warning: ‘-Werror=’ argument ‘-Werror=implicit-function-declaration’ is not valid for C++ cc1plus: warning: ‘-Werror=’ argument ‘-Werror=implicit-int’ is not valid for C++ cc1plus: warning: ‘-Werror=’ argument ‘-Werror=implicit-function-declaration’ is not valid for C++ cc1plus: warning: ‘-Werror=’ argument ‘-Werror=implicit-int’ is not valid for C++ cc1plus: warning: ‘-Werror=’ argument ‘-Werror=implicit-function-declaration’ is not valid for C++ cc1plus: warning: ‘-Werror=’ argument ‘-Werror=implicit-int’ is not valid for C++ cc1plus: warning: ‘-Werror=’ argument ‘-Werror=implicit-function-declaration’ is not valid for C++ cc1plus: warning: ‘-Werror=’ argument ‘-Werror=implicit-int’ is not valid for C++ cc1plus: warning: ‘-Werror=’ argument ‘-Werror=implicit-function-declaration’ is not valid for C++ cc1plus: warning: ‘-Werror=’ argument ‘-Werror=implicit-int’ is not valid for C++ cc1plus: warning: ‘-Werror=’ argument ‘-Werror=implicit-function-declaration’ is not valid for C++ cc1plus: warning: ‘-Werror=’ argument ‘-Werror=implicit-int’ is not valid for C++ cc1plus: warning: ‘-Werror=’ argument ‘-Werror=implicit-function-declaration’ is not valid for C++ cc1plus: warning: ‘-Werror=’ argument ‘-Werror=implicit-int’ is not valid for C++ cc1plus: warning: ‘-Werror=’ argument ‘-Werror=implicit-function-declaration’ is not valid for C++ cc1plus: warning: ‘-Werror=’ argument ‘-Werror=implicit-int’ is not valid for C++ g++ -O3 -DCOMPILER_OPTIONS="\"-O3 -g -Wl,--hash-style=both -O2 -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Werror=implicit-function-declaration -Werror=implicit-int -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -fasynchronous-unwind-tables -fno-omit-frame-pointer -O2 -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -fasynchronous-unwind-tables -fno-omit-frame-pointer \"" -g -Wl,--hash-style=both -O2 -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Werror=implicit-function-declaration -Werror=implicit-int -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -fasynchronous-unwind-tables -fno-omit-frame-pointer -O2 -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -fasynchronous-unwind-tables -fno-omit-frame-pointer \ -fno-strict-aliasing -DBOWTIE_VERSION="\"`cat VERSION`\"" -DBUILD_HOST="\"reproduciblebuild\"" -DBUILD_TIME="\"2024-01-19T00:00:00\"" -DCOMPILER_VERSION="\"`g++ -v 2>&1 | tail -1`\"" -D_LARGEFILE_SOURCE -D_FILE_OFFSET_BITS=64 -D_GNU_SOURCE -DPREFETCH_LOCALITY=2 -DBOWTIE_MM -DBOWTIE_SHARED_MEM -DNDEBUG -Wall -Wno-unused-parameter -Wno-reorder \ -I third_party \ -o bowtie-build-s ebwt_build.cpp \ ccnt_lut.cpp ref_read.cpp alphabet.cpp shmem.cpp edit.cpp ebwt.cpp bt2_locks.cpp tinythread.cpp bowtie_build_main.cpp \ -Wl,-z,relro -Wl,--as-needed -Wl,-z,now -specs=/usr/lib/rpm/redhat/redhat-hardened-ld -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -Wl,--build-id=sha1 -specs=/usr/lib/rpm/redhat/redhat-package-notes -lz -lpthread cc1plus: warning: ‘-Werror=’ argument ‘-Werror=implicit-function-declaration’ is not valid for C++ cc1plus: warning: ‘-Werror=’ argument ‘-Werror=implicit-int’ is not valid for C++ cc1plus: warning: ‘-Werror=’ argument ‘-Werror=implicit-function-declaration’ is not valid for C++ cc1plus: warning: ‘-Werror=’ argument ‘-Werror=implicit-int’ is not valid for C++ cc1plus: warning: ‘-Werror=’ argument ‘-Werror=implicit-function-declaration’ is not valid for C++ cc1plus: warning: ‘-Werror=’ argument ‘-Werror=implicit-int’ is not valid for C++ cc1plus: warning: ‘-Werror=’ argument ‘-Werror=implicit-function-declaration’ is not valid for C++ cc1plus: warning: ‘-Werror=’ argument ‘-Werror=implicit-int’ is not valid for C++ cc1plus: warning: ‘-Werror=’ argument ‘-Werror=implicit-function-declaration’ is not valid for C++ cc1plus: warning: ‘-Werror=’ argument ‘-Werror=implicit-int’ is not valid for C++ cc1plus: warning: ‘-Werror=’ argument ‘-Werror=implicit-function-declaration’ is not valid for C++ cc1plus: warning: ‘-Werror=’ argument ‘-Werror=implicit-int’ is not valid for C++ cc1plus: warning: ‘-Werror=’ argument ‘-Werror=implicit-function-declaration’ is not valid for C++ cc1plus: warning: ‘-Werror=’ argument ‘-Werror=implicit-int’ is not valid for C++ cc1plus: warning: ‘-Werror=’ argument ‘-Werror=implicit-function-declaration’ is not valid for C++ cc1plus: warning: ‘-Werror=’ argument ‘-Werror=implicit-int’ is not valid for C++ cc1plus: warning: ‘-Werror=’ argument ‘-Werror=implicit-function-declaration’ is not valid for C++ cc1plus: warning: ‘-Werror=’ argument ‘-Werror=implicit-int’ is not valid for C++ cc1plus: warning: ‘-Werror=’ argument ‘-Werror=implicit-function-declaration’ is not valid for C++ cc1plus: warning: ‘-Werror=’ argument ‘-Werror=implicit-int’ is not valid for C++ g++ -O3 \ -DCOMPILER_OPTIONS="\"-O3 -g -Wl,--hash-style=both -O2 -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Werror=implicit-function-declaration -Werror=implicit-int -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -fasynchronous-unwind-tables -fno-omit-frame-pointer -O2 -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -fasynchronous-unwind-tables -fno-omit-frame-pointer \"" -g -Wl,--hash-style=both -O2 -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Werror=implicit-function-declaration -Werror=implicit-int -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -fasynchronous-unwind-tables -fno-omit-frame-pointer -O2 -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -fasynchronous-unwind-tables -fno-omit-frame-pointer \ -fno-strict-aliasing -DBOWTIE_VERSION="\"`cat VERSION`\"" -DBUILD_HOST="\"reproduciblebuild\"" -DBUILD_TIME="\"2024-01-19T00:00:00\"" -DCOMPILER_VERSION="\"`g++ -v 2>&1 | tail -1`\"" -D_LARGEFILE_SOURCE -D_FILE_OFFSET_BITS=64 -D_GNU_SOURCE -DPREFETCH_LOCALITY=2 -DBOWTIE_MM -DBOWTIE_SHARED_MEM -DBOWTIE_64BIT_INDEX -Wall -Wno-unused-parameter -Wno-reorder \ -I third_party -I . \ -o bowtie-inspect-l bowtie_inspect.cpp \ ccnt_lut.cpp ref_read.cpp alphabet.cpp shmem.cpp edit.cpp ebwt.cpp bt2_locks.cpp tinythread.cpp \ -Wl,-z,relro -Wl,--as-needed -Wl,-z,now -specs=/usr/lib/rpm/redhat/redhat-hardened-ld -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -Wl,--build-id=sha1 -specs=/usr/lib/rpm/redhat/redhat-package-notes -lz -lpthread cc1plus: warning: ‘-Werror=’ argument ‘-Werror=implicit-function-declaration’ is not valid for C++ cc1plus: warning: ‘-Werror=’ argument ‘-Werror=implicit-int’ is not valid for C++ cc1plus: warning: ‘-Werror=’ argument ‘-Werror=implicit-function-declaration’ is not valid for C++ cc1plus: warning: ‘-Werror=’ argument ‘-Werror=implicit-int’ is not valid for C++ cc1plus: warning: ‘-Werror=’ argument ‘-Werror=implicit-function-declaration’ is not valid for C++ cc1plus: warning: ‘-Werror=’ argument ‘-Werror=implicit-int’ is not valid for C++ cc1plus: warning: ‘-Werror=’ argument ‘-Werror=implicit-function-declaration’ is not valid for C++ cc1plus: warning: ‘-Werror=’ argument ‘-Werror=implicit-int’ is not valid for C++ cc1plus: warning: ‘-Werror=’ argument ‘-Werror=implicit-function-declaration’ is not valid for C++ cc1plus: warning: ‘-Werror=’ argument ‘-Werror=implicit-int’ is not valid for C++ cc1plus: warning: ‘-Werror=’ argument ‘-Werror=implicit-function-declaration’ is not valid for C++ cc1plus: warning: ‘-Werror=’ argument ‘-Werror=implicit-int’ is not valid for C++ cc1plus: warning: ‘-Werror=’ argument ‘-Werror=implicit-function-declaration’ is not valid for C++ cc1plus: warning: ‘-Werror=’ argument ‘-Werror=implicit-int’ is not valid for C++ cc1plus: warning: ‘-Werror=’ argument ‘-Werror=implicit-function-declaration’ is not valid for C++ cc1plus: warning: ‘-Werror=’ argument ‘-Werror=implicit-int’ is not valid for C++ cc1plus: warning: ‘-Werror=’ argument ‘-Werror=implicit-function-declaration’ is not valid for C++ cc1plus: warning: ‘-Werror=’ argument ‘-Werror=implicit-int’ is not valid for C++ g++ -O3 -DCOMPILER_OPTIONS="\"-O3 -g -Wl,--hash-style=both -O2 -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Werror=implicit-function-declaration -Werror=implicit-int -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -fasynchronous-unwind-tables -fno-omit-frame-pointer -O2 -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -fasynchronous-unwind-tables -fno-omit-frame-pointer \"" -g -Wl,--hash-style=both -O2 -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Werror=implicit-function-declaration -Werror=implicit-int -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -fasynchronous-unwind-tables -fno-omit-frame-pointer -O2 -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -fasynchronous-unwind-tables -fno-omit-frame-pointer \ -fno-strict-aliasing -DBOWTIE_VERSION="\"`cat VERSION`\"" -DBUILD_HOST="\"reproduciblebuild\"" -DBUILD_TIME="\"2024-01-19T00:00:00\"" -DCOMPILER_VERSION="\"`g++ -v 2>&1 | tail -1`\"" -D_LARGEFILE_SOURCE -D_FILE_OFFSET_BITS=64 -D_GNU_SOURCE -DPREFETCH_LOCALITY=2 -DBOWTIE_MM -DBOWTIE_SHARED_MEM -DBOWTIE_64BIT_INDEX -DNDEBUG -Wall -Wno-unused-parameter -Wno-reorder \ -I third_party \ -o bowtie-build-l ebwt_build.cpp \ ccnt_lut.cpp ref_read.cpp alphabet.cpp shmem.cpp edit.cpp ebwt.cpp bt2_locks.cpp tinythread.cpp bowtie_build_main.cpp \ -Wl,-z,relro -Wl,--as-needed -Wl,-z,now -specs=/usr/lib/rpm/redhat/redhat-hardened-ld -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -Wl,--build-id=sha1 -specs=/usr/lib/rpm/redhat/redhat-package-notes -lz -lpthread cc1plus: warning: ‘-Werror=’ argument ‘-Werror=implicit-function-declaration’ is not valid for C++ cc1plus: warning: ‘-Werror=’ argument ‘-Werror=implicit-int’ is not valid for C++ cc1plus: warning: ‘-Werror=’ argument ‘-Werror=implicit-function-declaration’ is not valid for C++ cc1plus: warning: ‘-Werror=’ argument ‘-Werror=implicit-int’ is not valid for C++ cc1plus: warning: ‘-Werror=’ argument ‘-Werror=implicit-function-declaration’ is not valid for C++ cc1plus: warning: ‘-Werror=’ argument ‘-Werror=implicit-int’ is not valid for C++ cc1plus: warning: ‘-Werror=’ argument ‘-Werror=implicit-function-declaration’ is not valid for C++ cc1plus: warning: ‘-Werror=’ argument ‘-Werror=implicit-int’ is not valid for C++ cc1plus: warning: ‘-Werror=’ argument ‘-Werror=implicit-function-declaration’ is not valid for C++ cc1plus: warning: ‘-Werror=’ argument ‘-Werror=implicit-int’ is not valid for C++ cc1plus: warning: ‘-Werror=’ argument ‘-Werror=implicit-function-declaration’ is not valid for C++ cc1plus: warning: ‘-Werror=’ argument ‘-Werror=implicit-int’ is not valid for C++ cc1plus: warning: ‘-Werror=’ argument ‘-Werror=implicit-function-declaration’ is not valid for C++ cc1plus: warning: ‘-Werror=’ argument ‘-Werror=implicit-int’ is not valid for C++ cc1plus: warning: ‘-Werror=’ argument ‘-Werror=implicit-function-declaration’ is not valid for C++ cc1plus: warning: ‘-Werror=’ argument ‘-Werror=implicit-int’ is not valid for C++ cc1plus: warning: ‘-Werror=’ argument ‘-Werror=implicit-function-declaration’ is not valid for C++ cc1plus: warning: ‘-Werror=’ argument ‘-Werror=implicit-int’ is not valid for C++ cc1plus: warning: ‘-Werror=’ argument ‘-Werror=implicit-function-declaration’ is not valid for C++ cc1plus: warning: ‘-Werror=’ argument ‘-Werror=implicit-int’ is not valid for C++ g++ -O3 \ -DCOMPILER_OPTIONS="\"-O3 -g -Wl,--hash-style=both -O2 -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Werror=implicit-function-declaration -Werror=implicit-int -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -fasynchronous-unwind-tables -fno-omit-frame-pointer -O2 -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -fasynchronous-unwind-tables -fno-omit-frame-pointer \"" -g -Wl,--hash-style=both -O2 -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Werror=implicit-function-declaration -Werror=implicit-int -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -fasynchronous-unwind-tables -fno-omit-frame-pointer -O2 -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -fasynchronous-unwind-tables -fno-omit-frame-pointer \ -fno-strict-aliasing -DBOWTIE_VERSION="\"`cat VERSION`\"" -DBUILD_HOST="\"reproduciblebuild\"" -DBUILD_TIME="\"2024-01-19T00:00:00\"" -DCOMPILER_VERSION="\"`g++ -v 2>&1 | tail -1`\"" -D_LARGEFILE_SOURCE -D_FILE_OFFSET_BITS=64 -D_GNU_SOURCE -DPREFETCH_LOCALITY=2 -DBOWTIE_MM -DBOWTIE_SHARED_MEM -Wall -Wno-unused-parameter -Wno-reorder \ -I third_party -I . \ -o bowtie-inspect-s bowtie_inspect.cpp \ ccnt_lut.cpp ref_read.cpp alphabet.cpp shmem.cpp edit.cpp ebwt.cpp bt2_locks.cpp tinythread.cpp \ -Wl,-z,relro -Wl,--as-needed -Wl,-z,now -specs=/usr/lib/rpm/redhat/redhat-hardened-ld -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -Wl,--build-id=sha1 -specs=/usr/lib/rpm/redhat/redhat-package-notes -lz -lpthread cc1plus: warning: ‘-Werror=’ argument ‘-Werror=implicit-function-declaration’ is not valid for C++ cc1plus: warning: ‘-Werror=’ argument ‘-Werror=implicit-int’ is not valid for C++ cc1plus: warning: ‘-Werror=’ argument ‘-Werror=implicit-function-declaration’ is not valid for C++ cc1plus: warning: ‘-Werror=’ argument ‘-Werror=implicit-int’ is not valid for C++ cc1plus: warning: ‘-Werror=’ argument ‘-Werror=implicit-function-declaration’ is not valid for C++ cc1plus: warning: ‘-Werror=’ argument ‘-Werror=implicit-int’ is not valid for C++ cc1plus: warning: ‘-Werror=’ argument ‘-Werror=implicit-function-declaration’ is not valid for C++ cc1plus: warning: ‘-Werror=’ argument ‘-Werror=implicit-int’ is not valid for C++ cc1plus: warning: ‘-Werror=’ argument ‘-Werror=implicit-function-declaration’ is not valid for C++ cc1plus: warning: ‘-Werror=’ argument ‘-Werror=implicit-int’ is not valid for C++ cc1plus: warning: ‘-Werror=’ argument ‘-Werror=implicit-function-declaration’ is not valid for C++ cc1plus: warning: ‘-Werror=’ argument ‘-Werror=implicit-int’ is not valid for C++ cc1plus: warning: ‘-Werror=’ argument ‘-Werror=implicit-function-declaration’ is not valid for C++ cc1plus: warning: ‘-Werror=’ argument ‘-Werror=implicit-int’ is not valid for C++ cc1plus: warning: ‘-Werror=’ argument ‘-Werror=implicit-function-declaration’ is not valid for C++ cc1plus: warning: ‘-Werror=’ argument ‘-Werror=implicit-int’ is not valid for C++ cc1plus: warning: ‘-Werror=’ argument ‘-Werror=implicit-function-declaration’ is not valid for C++ cc1plus: warning: ‘-Werror=’ argument ‘-Werror=implicit-int’ is not valid for C++ g++ -O0 -g3 -DCOMPILER_OPTIONS="\"-O0 -g3 -g -Wl,--hash-style=both -O2 -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Werror=implicit-function-declaration -Werror=implicit-int -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -fasynchronous-unwind-tables -fno-omit-frame-pointer -O2 -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -fasynchronous-unwind-tables -fno-omit-frame-pointer \"" -g -Wl,--hash-style=both -O2 -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Werror=implicit-function-declaration -Werror=implicit-int -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -fasynchronous-unwind-tables -fno-omit-frame-pointer -O2 -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -fasynchronous-unwind-tables -fno-omit-frame-pointer \ -fno-strict-aliasing -DBOWTIE_VERSION="\"`cat VERSION`\"" -DBUILD_HOST="\"reproduciblebuild\"" -DBUILD_TIME="\"2024-01-19T00:00:00\"" -DCOMPILER_VERSION="\"`g++ -v 2>&1 | tail -1`\"" -D_LARGEFILE_SOURCE -D_FILE_OFFSET_BITS=64 -D_GNU_SOURCE -DPREFETCH_LOCALITY=2 -DBOWTIE_MM -DBOWTIE_SHARED_MEM -Wall -Wno-unused-parameter -Wno-reorder \ -I third_party \ -o bowtie-build-s-debug ebwt_build.cpp \ ccnt_lut.cpp ref_read.cpp alphabet.cpp shmem.cpp edit.cpp ebwt.cpp bt2_locks.cpp tinythread.cpp bowtie_build_main.cpp \ -Wl,-z,relro -Wl,--as-needed -Wl,-z,now -specs=/usr/lib/rpm/redhat/redhat-hardened-ld -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -Wl,--build-id=sha1 -specs=/usr/lib/rpm/redhat/redhat-package-notes -lz -lpthread cc1plus: warning: ‘-Werror=’ argument ‘-Werror=implicit-function-declaration’ is not valid for C++ cc1plus: warning: ‘-Werror=’ argument ‘-Werror=implicit-int’ is not valid for C++ In file included from ebwt.h:31, from ebwt_build.cpp:10: ref_read.h: In function ‘RefRecord fastaRefReadAppend(FileBuf&, bool, TStr&, TIndexOffU&, RefReadInParams&, std::string*) [with TStr = S2bDnaString]’: ref_read.h:239:46: warning: array subscript -1 is below array bounds of ‘uint8_t []’ {aka ‘unsigned char []’} [-Warray-bounds=] 239 | if(rparms.nsToAs && dna4Cat[c] == 2) c = 'A'; | ~~~~~~~~~^ In file included from ebwt.h:21: alphabet.h:140:16: note: while referencing ‘dna4Cat’ 140 | extern uint8_t dna4Cat[]; | ^~~~~~~ ref_read.h: In function ‘RefRecord fastaRefReadAppend(FileBuf&, bool, TStr&, TIndexOffU&, RefReadInParams&, std::string*) [with TStr = SString]’: ref_read.h:239:46: warning: array subscript -1 is below array bounds of ‘uint8_t []’ {aka ‘unsigned char []’} [-Warray-bounds=] 239 | if(rparms.nsToAs && dna4Cat[c] == 2) c = 'A'; | ~~~~~~~~~^ alphabet.h:140:16: note: while referencing ‘dna4Cat’ 140 | extern uint8_t dna4Cat[]; | ^~~~~~~ In file included from diff_sample.h:14, from blockwise_sa.h:17, from ebwt.h:25: multikey_qsort.h: In function ‘void mkeyQSortSuf2(const T&, size_t, TIndexOffU*, size_t, TIndexOffU*, int, size_t, size_t, size_t, size_t, EList*) [with T = S2bDnaString]’: multikey_qsort.h:597:52: warning: ‘tmp2’ may be used uninitialized [-Wmaybe-uninitialized] 597 | block_list.back().push_back(tmp2); | ~~~~~~~~~~~~~~~~~~~~~~~~~~~^~~~~~ In file included from ebwt_build.cpp:8: ds.h:494:14: note: by argument 2 of type ‘const QSortRange&’ to ‘void EList::push_back(const T&) [with T = QSortRange; int S = 128]’ declared here 494 | void push_back(const T& el) { | ^~~~~~~~~ multikey_qsort.h:596:36: note: ‘tmp2’ declared here 596 | QSortRange tmp2; | ^~~~ multikey_qsort.h:606:52: warning: ‘tmp3’ may be used uninitialized [-Wmaybe-uninitialized] 606 | block_list.back().push_back(tmp3); | ~~~~~~~~~~~~~~~~~~~~~~~~~~~^~~~~~ ds.h:494:14: note: by argument 2 of type ‘const QSortRange&’ to ‘void EList::push_back(const T&) [with T = QSortRange; int S = 128]’ declared here 494 | void push_back(const T& el) { | ^~~~~~~~~ multikey_qsort.h:605:36: note: ‘tmp3’ declared here 605 | QSortRange tmp3; | ^~~~ cc1plus: warning: ‘-Werror=’ argument ‘-Werror=implicit-function-declaration’ is not valid for C++ cc1plus: warning: ‘-Werror=’ argument ‘-Werror=implicit-int’ is not valid for C++ cc1plus: warning: ‘-Werror=’ argument ‘-Werror=implicit-function-declaration’ is not valid for C++ cc1plus: warning: ‘-Werror=’ argument ‘-Werror=implicit-int’ is not valid for C++ cc1plus: warning: ‘-Werror=’ argument ‘-Werror=implicit-function-declaration’ is not valid for C++ cc1plus: warning: ‘-Werror=’ argument ‘-Werror=implicit-int’ is not valid for C++ cc1plus: warning: ‘-Werror=’ argument ‘-Werror=implicit-function-declaration’ is not valid for C++ cc1plus: warning: ‘-Werror=’ argument ‘-Werror=implicit-int’ is not valid for C++ cc1plus: warning: ‘-Werror=’ argument ‘-Werror=implicit-function-declaration’ is not valid for C++ cc1plus: warning: ‘-Werror=’ argument ‘-Werror=implicit-int’ is not valid for C++ cc1plus: warning: ‘-Werror=’ argument ‘-Werror=implicit-function-declaration’ is not valid for C++ cc1plus: warning: ‘-Werror=’ argument ‘-Werror=implicit-int’ is not valid for C++ cc1plus: warning: ‘-Werror=’ argument ‘-Werror=implicit-function-declaration’ is not valid for C++ cc1plus: warning: ‘-Werror=’ argument ‘-Werror=implicit-int’ is not valid for C++ cc1plus: warning: ‘-Werror=’ argument ‘-Werror=implicit-function-declaration’ is not valid for C++ cc1plus: warning: ‘-Werror=’ argument ‘-Werror=implicit-int’ is not valid for C++ cc1plus: warning: ‘-Werror=’ argument ‘-Werror=implicit-function-declaration’ is not valid for C++ cc1plus: warning: ‘-Werror=’ argument ‘-Werror=implicit-int’ is not valid for C++ g++ -O3 -DCOMPILER_OPTIONS="\"-O3 -g -Wl,--hash-style=both -O2 -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Werror=implicit-function-declaration -Werror=implicit-int -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -fasynchronous-unwind-tables -fno-omit-frame-pointer -O2 -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -fasynchronous-unwind-tables -fno-omit-frame-pointer \"" -g -Wl,--hash-style=both -O2 -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Werror=implicit-function-declaration -Werror=implicit-int -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -fasynchronous-unwind-tables -fno-omit-frame-pointer -O2 -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -fasynchronous-unwind-tables -fno-omit-frame-pointer \ -fno-strict-aliasing -DBOWTIE_VERSION="\"`cat VERSION`\"" -DBUILD_HOST="\"reproduciblebuild\"" -DBUILD_TIME="\"2024-01-19T00:00:00\"" -DCOMPILER_VERSION="\"`g++ -v 2>&1 | tail -1`\"" -D_LARGEFILE_SOURCE -D_FILE_OFFSET_BITS=64 -D_GNU_SOURCE -DPREFETCH_LOCALITY=2 -DBOWTIE_MM -DBOWTIE_SHARED_MEM -DNDEBUG -Wall -Wno-unused-parameter -Wno-reorder \ -I third_party \ -o bowtie-align-s ebwt_search.cpp \ ccnt_lut.cpp ref_read.cpp alphabet.cpp shmem.cpp edit.cpp ebwt.cpp bt2_locks.cpp tinythread.cpp qual.cpp pat.cpp ebwt_search_util.cpp ref_aligner.cpp log.cpp hit_set.cpp sam.cpp hit.cpp bowtie_main.cpp \ -Wl,-z,relro -Wl,--as-needed -Wl,-z,now -specs=/usr/lib/rpm/redhat/redhat-hardened-ld -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -Wl,--build-id=sha1 -specs=/usr/lib/rpm/redhat/redhat-package-notes -lz -lpthread cc1plus: warning: ‘-Werror=’ argument ‘-Werror=implicit-function-declaration’ is not valid for C++ cc1plus: warning: ‘-Werror=’ argument ‘-Werror=implicit-int’ is not valid for C++ cc1plus: warning: ‘-Werror=’ argument ‘-Werror=implicit-function-declaration’ is not valid for C++ cc1plus: warning: ‘-Werror=’ argument ‘-Werror=implicit-int’ is not valid for C++ cc1plus: warning: ‘-Werror=’ argument ‘-Werror=implicit-function-declaration’ is not valid for C++ cc1plus: warning: ‘-Werror=’ argument ‘-Werror=implicit-int’ is not valid for C++ cc1plus: warning: ‘-Werror=’ argument ‘-Werror=implicit-function-declaration’ is not valid for C++ cc1plus: warning: ‘-Werror=’ argument ‘-Werror=implicit-int’ is not valid for C++ cc1plus: warning: ‘-Werror=’ argument ‘-Werror=implicit-function-declaration’ is not valid for C++ cc1plus: warning: ‘-Werror=’ argument ‘-Werror=implicit-int’ is not valid for C++ cc1plus: warning: ‘-Werror=’ argument ‘-Werror=implicit-function-declaration’ is not valid for C++ cc1plus: warning: ‘-Werror=’ argument ‘-Werror=implicit-int’ is not valid for C++ cc1plus: warning: ‘-Werror=’ argument ‘-Werror=implicit-function-declaration’ is not valid for C++ cc1plus: warning: ‘-Werror=’ argument ‘-Werror=implicit-int’ is not valid for C++ cc1plus: warning: ‘-Werror=’ argument ‘-Werror=implicit-function-declaration’ is not valid for C++ cc1plus: warning: ‘-Werror=’ argument ‘-Werror=implicit-int’ is not valid for C++ cc1plus: warning: ‘-Werror=’ argument ‘-Werror=implicit-function-declaration’ is not valid for C++ cc1plus: warning: ‘-Werror=’ argument ‘-Werror=implicit-int’ is not valid for C++ cc1plus: warning: ‘-Werror=’ argument ‘-Werror=implicit-function-declaration’ is not valid for C++ cc1plus: warning: ‘-Werror=’ argument ‘-Werror=implicit-int’ is not valid for C++ cc1plus: warning: ‘-Werror=’ argument ‘-Werror=implicit-function-declaration’ is not valid for C++ cc1plus: warning: ‘-Werror=’ argument ‘-Werror=implicit-int’ is not valid for C++ cc1plus: warning: ‘-Werror=’ argument ‘-Werror=implicit-function-declaration’ is not valid for C++ cc1plus: warning: ‘-Werror=’ argument ‘-Werror=implicit-int’ is not valid for C++ cc1plus: warning: ‘-Werror=’ argument ‘-Werror=implicit-function-declaration’ is not valid for C++ cc1plus: warning: ‘-Werror=’ argument ‘-Werror=implicit-int’ is not valid for C++ cc1plus: warning: ‘-Werror=’ argument ‘-Werror=implicit-function-declaration’ is not valid for C++ cc1plus: warning: ‘-Werror=’ argument ‘-Werror=implicit-int’ is not valid for C++ cc1plus: warning: ‘-Werror=’ argument ‘-Werror=implicit-function-declaration’ is not valid for C++ cc1plus: warning: ‘-Werror=’ argument ‘-Werror=implicit-int’ is not valid for C++ cc1plus: warning: ‘-Werror=’ argument ‘-Werror=implicit-function-declaration’ is not valid for C++ cc1plus: warning: ‘-Werror=’ argument ‘-Werror=implicit-int’ is not valid for C++ cc1plus: warning: ‘-Werror=’ argument ‘-Werror=implicit-function-declaration’ is not valid for C++ cc1plus: warning: ‘-Werror=’ argument ‘-Werror=implicit-int’ is not valid for C++ cc1plus: warning: ‘-Werror=’ argument ‘-Werror=implicit-function-declaration’ is not valid for C++ cc1plus: warning: ‘-Werror=’ argument ‘-Werror=implicit-int’ is not valid for C++ g++ -O0 -g3 -DCOMPILER_OPTIONS="\"-O0 -g3 -g -Wl,--hash-style=both -O2 -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Werror=implicit-function-declaration -Werror=implicit-int -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -fasynchronous-unwind-tables -fno-omit-frame-pointer -O2 -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -fasynchronous-unwind-tables -fno-omit-frame-pointer \"" -g -Wl,--hash-style=both -O2 -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Werror=implicit-function-declaration -Werror=implicit-int -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -fasynchronous-unwind-tables -fno-omit-frame-pointer -O2 -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -fasynchronous-unwind-tables -fno-omit-frame-pointer \ -fno-strict-aliasing -DBOWTIE_VERSION="\"`cat VERSION`\"" -DBUILD_HOST="\"reproduciblebuild\"" -DBUILD_TIME="\"2024-01-19T00:00:00\"" -DCOMPILER_VERSION="\"`g++ -v 2>&1 | tail -1`\"" -D_LARGEFILE_SOURCE -D_FILE_OFFSET_BITS=64 -D_GNU_SOURCE -DPREFETCH_LOCALITY=2 -DBOWTIE_MM -DBOWTIE_SHARED_MEM -DBOWTIE_64BIT_INDEX -Wall -Wno-unused-parameter -Wno-reorder \ -I third_party \ -o bowtie-build-l-debug ebwt_build.cpp \ ccnt_lut.cpp ref_read.cpp alphabet.cpp shmem.cpp edit.cpp ebwt.cpp bt2_locks.cpp tinythread.cpp bowtie_build_main.cpp \ -Wl,-z,relro -Wl,--as-needed -Wl,-z,now -specs=/usr/lib/rpm/redhat/redhat-hardened-ld -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -Wl,--build-id=sha1 -specs=/usr/lib/rpm/redhat/redhat-package-notes -lz -lpthread cc1plus: warning: ‘-Werror=’ argument ‘-Werror=implicit-function-declaration’ is not valid for C++ cc1plus: warning: ‘-Werror=’ argument ‘-Werror=implicit-int’ is not valid for C++ In file included from ebwt.h:31, from ebwt_build.cpp:10: ref_read.h: In function ‘RefRecord fastaRefReadAppend(FileBuf&, bool, TStr&, TIndexOffU&, RefReadInParams&, std::string*) [with TStr = S2bDnaString]’: ref_read.h:239:46: warning: array subscript -1 is below array bounds of ‘uint8_t []’ {aka ‘unsigned char []’} [-Warray-bounds=] 239 | if(rparms.nsToAs && dna4Cat[c] == 2) c = 'A'; | ~~~~~~~~~^ In file included from ebwt.h:21: alphabet.h:140:16: note: while referencing ‘dna4Cat’ 140 | extern uint8_t dna4Cat[]; | ^~~~~~~ ref_read.h: In function ‘RefRecord fastaRefReadAppend(FileBuf&, bool, TStr&, TIndexOffU&, RefReadInParams&, std::string*) [with TStr = SString]’: ref_read.h:239:46: warning: array subscript -1 is below array bounds of ‘uint8_t []’ {aka ‘unsigned char []’} [-Warray-bounds=] 239 | if(rparms.nsToAs && dna4Cat[c] == 2) c = 'A'; | ~~~~~~~~~^ alphabet.h:140:16: note: while referencing ‘dna4Cat’ 140 | extern uint8_t dna4Cat[]; | ^~~~~~~ In file included from diff_sample.h:14, from blockwise_sa.h:17, from ebwt.h:25: multikey_qsort.h: In function ‘void mkeyQSortSuf2(const T&, size_t, TIndexOffU*, size_t, TIndexOffU*, int, size_t, size_t, size_t, size_t, EList*) [with T = S2bDnaString]’: multikey_qsort.h:597:52: warning: ‘tmp2’ may be used uninitialized [-Wmaybe-uninitialized] 597 | block_list.back().push_back(tmp2); | ~~~~~~~~~~~~~~~~~~~~~~~~~~~^~~~~~ In file included from ebwt_build.cpp:8: ds.h:494:14: note: by argument 2 of type ‘const QSortRange&’ to ‘void EList::push_back(const T&) [with T = QSortRange; int S = 128]’ declared here 494 | void push_back(const T& el) { | ^~~~~~~~~ multikey_qsort.h:596:36: note: ‘tmp2’ declared here 596 | QSortRange tmp2; | ^~~~ multikey_qsort.h:606:52: warning: ‘tmp3’ may be used uninitialized [-Wmaybe-uninitialized] 606 | block_list.back().push_back(tmp3); | ~~~~~~~~~~~~~~~~~~~~~~~~~~~^~~~~~ ds.h:494:14: note: by argument 2 of type ‘const QSortRange&’ to ‘void EList::push_back(const T&) [with T = QSortRange; int S = 128]’ declared here 494 | void push_back(const T& el) { | ^~~~~~~~~ multikey_qsort.h:605:36: note: ‘tmp3’ declared here 605 | QSortRange tmp3; | ^~~~ cc1plus: warning: ‘-Werror=’ argument ‘-Werror=implicit-function-declaration’ is not valid for C++ cc1plus: warning: ‘-Werror=’ argument ‘-Werror=implicit-int’ is not valid for C++ cc1plus: warning: ‘-Werror=’ argument ‘-Werror=implicit-function-declaration’ is not valid for C++ cc1plus: warning: ‘-Werror=’ argument ‘-Werror=implicit-int’ is not valid for C++ cc1plus: warning: ‘-Werror=’ argument ‘-Werror=implicit-function-declaration’ is not valid for C++ cc1plus: warning: ‘-Werror=’ argument ‘-Werror=implicit-int’ is not valid for C++ cc1plus: warning: ‘-Werror=’ argument ‘-Werror=implicit-function-declaration’ is not valid for C++ cc1plus: warning: ‘-Werror=’ argument ‘-Werror=implicit-int’ is not valid for C++ cc1plus: warning: ‘-Werror=’ argument ‘-Werror=implicit-function-declaration’ is not valid for C++ cc1plus: warning: ‘-Werror=’ argument ‘-Werror=implicit-int’ is not valid for C++ cc1plus: warning: ‘-Werror=’ argument ‘-Werror=implicit-function-declaration’ is not valid for C++ cc1plus: warning: ‘-Werror=’ argument ‘-Werror=implicit-int’ is not valid for C++ cc1plus: warning: ‘-Werror=’ argument ‘-Werror=implicit-function-declaration’ is not valid for C++ cc1plus: warning: ‘-Werror=’ argument ‘-Werror=implicit-int’ is not valid for C++ cc1plus: warning: ‘-Werror=’ argument ‘-Werror=implicit-function-declaration’ is not valid for C++ cc1plus: warning: ‘-Werror=’ argument ‘-Werror=implicit-int’ is not valid for C++ cc1plus: warning: ‘-Werror=’ argument ‘-Werror=implicit-function-declaration’ is not valid for C++ cc1plus: warning: ‘-Werror=’ argument ‘-Werror=implicit-int’ is not valid for C++ g++ -O3 -DCOMPILER_OPTIONS="\"-O3 -g -Wl,--hash-style=both -O2 -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Werror=implicit-function-declaration -Werror=implicit-int -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -fasynchronous-unwind-tables -fno-omit-frame-pointer -O2 -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -fasynchronous-unwind-tables -fno-omit-frame-pointer \"" -g -Wl,--hash-style=both -O2 -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Werror=implicit-function-declaration -Werror=implicit-int -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -fasynchronous-unwind-tables -fno-omit-frame-pointer -O2 -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -fasynchronous-unwind-tables -fno-omit-frame-pointer \ -fno-strict-aliasing -DBOWTIE_VERSION="\"`cat VERSION`\"" -DBUILD_HOST="\"reproduciblebuild\"" -DBUILD_TIME="\"2024-01-19T00:00:00\"" -DCOMPILER_VERSION="\"`g++ -v 2>&1 | tail -1`\"" -D_LARGEFILE_SOURCE -D_FILE_OFFSET_BITS=64 -D_GNU_SOURCE -DPREFETCH_LOCALITY=2 -DBOWTIE_MM -DBOWTIE_SHARED_MEM -DNDEBUG -DBOWTIE_64BIT_INDEX -Wall -Wno-unused-parameter -Wno-reorder \ -I third_party \ -o bowtie-align-l ebwt_search.cpp \ ccnt_lut.cpp ref_read.cpp alphabet.cpp shmem.cpp edit.cpp ebwt.cpp bt2_locks.cpp tinythread.cpp qual.cpp pat.cpp ebwt_search_util.cpp ref_aligner.cpp log.cpp hit_set.cpp sam.cpp hit.cpp bowtie_main.cpp \ -Wl,-z,relro -Wl,--as-needed -Wl,-z,now -specs=/usr/lib/rpm/redhat/redhat-hardened-ld -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -Wl,--build-id=sha1 -specs=/usr/lib/rpm/redhat/redhat-package-notes -lz -lpthread cc1plus: warning: ‘-Werror=’ argument ‘-Werror=implicit-function-declaration’ is not valid for C++ cc1plus: warning: ‘-Werror=’ argument ‘-Werror=implicit-int’ is not valid for C++ cc1plus: warning: ‘-Werror=’ argument ‘-Werror=implicit-function-declaration’ is not valid for C++ cc1plus: warning: ‘-Werror=’ argument ‘-Werror=implicit-int’ is not valid for C++ cc1plus: warning: ‘-Werror=’ argument ‘-Werror=implicit-function-declaration’ is not valid for C++ cc1plus: warning: ‘-Werror=’ argument ‘-Werror=implicit-int’ is not valid for C++ cc1plus: warning: ‘-Werror=’ argument ‘-Werror=implicit-function-declaration’ is not valid for C++ cc1plus: warning: ‘-Werror=’ argument ‘-Werror=implicit-int’ is not valid for C++ cc1plus: warning: ‘-Werror=’ argument ‘-Werror=implicit-function-declaration’ is not valid for C++ cc1plus: warning: ‘-Werror=’ argument ‘-Werror=implicit-int’ is not valid for C++ cc1plus: warning: ‘-Werror=’ argument ‘-Werror=implicit-function-declaration’ is not valid for C++ cc1plus: warning: ‘-Werror=’ argument ‘-Werror=implicit-int’ is not valid for C++ cc1plus: warning: ‘-Werror=’ argument ‘-Werror=implicit-function-declaration’ is not valid for C++ cc1plus: warning: ‘-Werror=’ argument ‘-Werror=implicit-int’ is not valid for C++ cc1plus: warning: ‘-Werror=’ argument ‘-Werror=implicit-function-declaration’ is not valid for C++ cc1plus: warning: ‘-Werror=’ argument ‘-Werror=implicit-int’ is not valid for C++ cc1plus: warning: ‘-Werror=’ argument ‘-Werror=implicit-function-declaration’ is not valid for C++ cc1plus: warning: ‘-Werror=’ argument ‘-Werror=implicit-int’ is not valid for C++ cc1plus: warning: ‘-Werror=’ argument ‘-Werror=implicit-function-declaration’ is not valid for C++ cc1plus: warning: ‘-Werror=’ argument ‘-Werror=implicit-int’ is not valid for C++ cc1plus: warning: ‘-Werror=’ argument ‘-Werror=implicit-function-declaration’ is not valid for C++ cc1plus: warning: ‘-Werror=’ argument ‘-Werror=implicit-int’ is not valid for C++ cc1plus: warning: ‘-Werror=’ argument ‘-Werror=implicit-function-declaration’ is not valid for C++ cc1plus: warning: ‘-Werror=’ argument ‘-Werror=implicit-int’ is not valid for C++ cc1plus: warning: ‘-Werror=’ argument ‘-Werror=implicit-function-declaration’ is not valid for C++ cc1plus: warning: ‘-Werror=’ argument ‘-Werror=implicit-int’ is not valid for C++ cc1plus: warning: ‘-Werror=’ argument ‘-Werror=implicit-function-declaration’ is not valid for C++ cc1plus: warning: ‘-Werror=’ argument ‘-Werror=implicit-int’ is not valid for C++ cc1plus: warning: ‘-Werror=’ argument ‘-Werror=implicit-function-declaration’ is not valid for C++ cc1plus: warning: ‘-Werror=’ argument ‘-Werror=implicit-int’ is not valid for C++ cc1plus: warning: ‘-Werror=’ argument ‘-Werror=implicit-function-declaration’ is not valid for C++ cc1plus: warning: ‘-Werror=’ argument ‘-Werror=implicit-int’ is not valid for C++ cc1plus: warning: ‘-Werror=’ argument ‘-Werror=implicit-function-declaration’ is not valid for C++ cc1plus: warning: ‘-Werror=’ argument ‘-Werror=implicit-int’ is not valid for C++ cc1plus: warning: ‘-Werror=’ argument ‘-Werror=implicit-function-declaration’ is not valid for C++ cc1plus: warning: ‘-Werror=’ argument ‘-Werror=implicit-int’ is not valid for C++ g++ -O0 -g3 \ -DCOMPILER_OPTIONS="\"-O0 -g3 -g -Wl,--hash-style=both -O2 -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Werror=implicit-function-declaration -Werror=implicit-int -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -fasynchronous-unwind-tables -fno-omit-frame-pointer -O2 -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -fasynchronous-unwind-tables -fno-omit-frame-pointer \"" -g -Wl,--hash-style=both -O2 -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Werror=implicit-function-declaration -Werror=implicit-int -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -fasynchronous-unwind-tables -fno-omit-frame-pointer -O2 -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -fasynchronous-unwind-tables -fno-omit-frame-pointer \ -fno-strict-aliasing -DBOWTIE_VERSION="\"`cat VERSION`\"" -DBUILD_HOST="\"reproduciblebuild\"" -DBUILD_TIME="\"2024-01-19T00:00:00\"" -DCOMPILER_VERSION="\"`g++ -v 2>&1 | tail -1`\"" -D_LARGEFILE_SOURCE -D_FILE_OFFSET_BITS=64 -D_GNU_SOURCE -DPREFETCH_LOCALITY=2 -DBOWTIE_MM -DBOWTIE_SHARED_MEM -Wall -Wno-unused-parameter -Wno-reorder \ -I third_party \ -o bowtie-align-s-debug ebwt_search.cpp \ ccnt_lut.cpp ref_read.cpp alphabet.cpp shmem.cpp edit.cpp ebwt.cpp bt2_locks.cpp tinythread.cpp qual.cpp pat.cpp ebwt_search_util.cpp ref_aligner.cpp log.cpp hit_set.cpp sam.cpp hit.cpp bowtie_main.cpp \ -Wl,-z,relro -Wl,--as-needed -Wl,-z,now -specs=/usr/lib/rpm/redhat/redhat-hardened-ld -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -Wl,--build-id=sha1 -specs=/usr/lib/rpm/redhat/redhat-package-notes -lz -lpthread cc1plus: warning: ‘-Werror=’ argument ‘-Werror=implicit-function-declaration’ is not valid for C++ cc1plus: warning: ‘-Werror=’ argument ‘-Werror=implicit-int’ is not valid for C++ cc1plus: warning: ‘-Werror=’ argument ‘-Werror=implicit-function-declaration’ is not valid for C++ cc1plus: warning: ‘-Werror=’ argument ‘-Werror=implicit-int’ is not valid for C++ cc1plus: warning: ‘-Werror=’ argument ‘-Werror=implicit-function-declaration’ is not valid for C++ cc1plus: warning: ‘-Werror=’ argument ‘-Werror=implicit-int’ is not valid for C++ cc1plus: warning: ‘-Werror=’ argument ‘-Werror=implicit-function-declaration’ is not valid for C++ cc1plus: warning: ‘-Werror=’ argument ‘-Werror=implicit-int’ is not valid for C++ cc1plus: warning: ‘-Werror=’ argument ‘-Werror=implicit-function-declaration’ is not valid for C++ cc1plus: warning: ‘-Werror=’ argument ‘-Werror=implicit-int’ is not valid for C++ cc1plus: warning: ‘-Werror=’ argument ‘-Werror=implicit-function-declaration’ is not valid for C++ cc1plus: warning: ‘-Werror=’ argument ‘-Werror=implicit-int’ is not valid for C++ cc1plus: warning: ‘-Werror=’ argument ‘-Werror=implicit-function-declaration’ is not valid for C++ cc1plus: warning: ‘-Werror=’ argument ‘-Werror=implicit-int’ is not valid for C++ cc1plus: warning: ‘-Werror=’ argument ‘-Werror=implicit-function-declaration’ is not valid for C++ cc1plus: warning: ‘-Werror=’ argument ‘-Werror=implicit-int’ is not valid for C++ cc1plus: warning: ‘-Werror=’ argument ‘-Werror=implicit-function-declaration’ is not valid for C++ cc1plus: warning: ‘-Werror=’ argument ‘-Werror=implicit-int’ is not valid for C++ cc1plus: warning: ‘-Werror=’ argument ‘-Werror=implicit-function-declaration’ is not valid for C++ cc1plus: warning: ‘-Werror=’ argument ‘-Werror=implicit-int’ is not valid for C++ cc1plus: warning: ‘-Werror=’ argument ‘-Werror=implicit-function-declaration’ is not valid for C++ cc1plus: warning: ‘-Werror=’ argument ‘-Werror=implicit-int’ is not valid for C++ cc1plus: warning: ‘-Werror=’ argument ‘-Werror=implicit-function-declaration’ is not valid for C++ cc1plus: warning: ‘-Werror=’ argument ‘-Werror=implicit-int’ is not valid for C++ cc1plus: warning: ‘-Werror=’ argument ‘-Werror=implicit-function-declaration’ is not valid for C++ cc1plus: warning: ‘-Werror=’ argument ‘-Werror=implicit-int’ is not valid for C++ cc1plus: warning: ‘-Werror=’ argument ‘-Werror=implicit-function-declaration’ is not valid for C++ cc1plus: warning: ‘-Werror=’ argument ‘-Werror=implicit-int’ is not valid for C++ cc1plus: warning: ‘-Werror=’ argument ‘-Werror=implicit-function-declaration’ is not valid for C++ cc1plus: warning: ‘-Werror=’ argument ‘-Werror=implicit-int’ is not valid for C++ cc1plus: warning: ‘-Werror=’ argument ‘-Werror=implicit-function-declaration’ is not valid for C++ cc1plus: warning: ‘-Werror=’ argument ‘-Werror=implicit-int’ is not valid for C++ cc1plus: warning: ‘-Werror=’ argument ‘-Werror=implicit-function-declaration’ is not valid for C++ cc1plus: warning: ‘-Werror=’ argument ‘-Werror=implicit-int’ is not valid for C++ cc1plus: warning: ‘-Werror=’ argument ‘-Werror=implicit-function-declaration’ is not valid for C++ cc1plus: warning: ‘-Werror=’ argument ‘-Werror=implicit-int’ is not valid for C++ g++ -O0 -g3 \ -DCOMPILER_OPTIONS="\"-O0 -g3 -g -Wl,--hash-style=both -O2 -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Werror=implicit-function-declaration -Werror=implicit-int -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -fasynchronous-unwind-tables -fno-omit-frame-pointer -O2 -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -fasynchronous-unwind-tables -fno-omit-frame-pointer \"" -g -Wl,--hash-style=both -O2 -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Werror=implicit-function-declaration -Werror=implicit-int -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -fasynchronous-unwind-tables -fno-omit-frame-pointer -O2 -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -fasynchronous-unwind-tables -fno-omit-frame-pointer \ -fno-strict-aliasing -DBOWTIE_VERSION="\"`cat VERSION`\"" -DBUILD_HOST="\"reproduciblebuild\"" -DBUILD_TIME="\"2024-01-19T00:00:00\"" -DCOMPILER_VERSION="\"`g++ -v 2>&1 | tail -1`\"" -D_LARGEFILE_SOURCE -D_FILE_OFFSET_BITS=64 -D_GNU_SOURCE -DPREFETCH_LOCALITY=2 -DBOWTIE_MM -DBOWTIE_SHARED_MEM -DBOWTIE_64BIT_INDEX -Wall -Wno-unused-parameter -Wno-reorder \ -I third_party \ -o bowtie-align-l-debug ebwt_search.cpp \ ccnt_lut.cpp ref_read.cpp alphabet.cpp shmem.cpp edit.cpp ebwt.cpp bt2_locks.cpp tinythread.cpp qual.cpp pat.cpp ebwt_search_util.cpp ref_aligner.cpp log.cpp hit_set.cpp sam.cpp hit.cpp bowtie_main.cpp \ -Wl,-z,relro -Wl,--as-needed -Wl,-z,now -specs=/usr/lib/rpm/redhat/redhat-hardened-ld -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -Wl,--build-id=sha1 -specs=/usr/lib/rpm/redhat/redhat-package-notes -lz -lpthread cc1plus: warning: ‘-Werror=’ argument ‘-Werror=implicit-function-declaration’ is not valid for C++ cc1plus: warning: ‘-Werror=’ argument ‘-Werror=implicit-int’ is not valid for C++ cc1plus: warning: ‘-Werror=’ argument ‘-Werror=implicit-function-declaration’ is not valid for C++ cc1plus: warning: ‘-Werror=’ argument ‘-Werror=implicit-int’ is not valid for C++ cc1plus: warning: ‘-Werror=’ argument ‘-Werror=implicit-function-declaration’ is not valid for C++ cc1plus: warning: ‘-Werror=’ argument ‘-Werror=implicit-int’ is not valid for C++ cc1plus: warning: ‘-Werror=’ argument ‘-Werror=implicit-function-declaration’ is not valid for C++ cc1plus: warning: ‘-Werror=’ argument ‘-Werror=implicit-int’ is not valid for C++ cc1plus: warning: ‘-Werror=’ argument ‘-Werror=implicit-function-declaration’ is not valid for C++ cc1plus: warning: ‘-Werror=’ argument ‘-Werror=implicit-int’ is not valid for C++ cc1plus: warning: ‘-Werror=’ argument ‘-Werror=implicit-function-declaration’ is not valid for C++ cc1plus: warning: ‘-Werror=’ argument ‘-Werror=implicit-int’ is not valid for C++ cc1plus: warning: ‘-Werror=’ argument ‘-Werror=implicit-function-declaration’ is not valid for C++ cc1plus: warning: ‘-Werror=’ argument ‘-Werror=implicit-int’ is not valid for C++ cc1plus: warning: ‘-Werror=’ argument ‘-Werror=implicit-function-declaration’ is not valid for C++ cc1plus: warning: ‘-Werror=’ argument ‘-Werror=implicit-int’ is not valid for C++ cc1plus: warning: ‘-Werror=’ argument ‘-Werror=implicit-function-declaration’ is not valid for C++ cc1plus: warning: ‘-Werror=’ argument ‘-Werror=implicit-int’ is not valid for C++ cc1plus: warning: ‘-Werror=’ argument ‘-Werror=implicit-function-declaration’ is not valid for C++ cc1plus: warning: ‘-Werror=’ argument ‘-Werror=implicit-int’ is not valid for C++ cc1plus: warning: ‘-Werror=’ argument ‘-Werror=implicit-function-declaration’ is not valid for C++ cc1plus: warning: ‘-Werror=’ argument ‘-Werror=implicit-int’ is not valid for C++ cc1plus: warning: ‘-Werror=’ argument ‘-Werror=implicit-function-declaration’ is not valid for C++ cc1plus: warning: ‘-Werror=’ argument ‘-Werror=implicit-int’ is not valid for C++ cc1plus: warning: ‘-Werror=’ argument ‘-Werror=implicit-function-declaration’ is not valid for C++ cc1plus: warning: ‘-Werror=’ argument ‘-Werror=implicit-int’ is not valid for C++ cc1plus: warning: ‘-Werror=’ argument ‘-Werror=implicit-function-declaration’ is not valid for C++ cc1plus: warning: ‘-Werror=’ argument ‘-Werror=implicit-int’ is not valid for C++ cc1plus: warning: ‘-Werror=’ argument ‘-Werror=implicit-function-declaration’ is not valid for C++ cc1plus: warning: ‘-Werror=’ argument ‘-Werror=implicit-int’ is not valid for C++ cc1plus: warning: ‘-Werror=’ argument ‘-Werror=implicit-function-declaration’ is not valid for C++ cc1plus: warning: ‘-Werror=’ argument ‘-Werror=implicit-int’ is not valid for C++ cc1plus: warning: ‘-Werror=’ argument ‘-Werror=implicit-function-declaration’ is not valid for C++ cc1plus: warning: ‘-Werror=’ argument ‘-Werror=implicit-int’ is not valid for C++ cc1plus: warning: ‘-Werror=’ argument ‘-Werror=implicit-function-declaration’ is not valid for C++ cc1plus: warning: ‘-Werror=’ argument ‘-Werror=implicit-int’ is not valid for C++ + RPM_EC=0 ++ jobs -p + exit 0 Executing(%install): /bin/sh -e /var/tmp/rpm-tmp.tF7ORM + umask 022 + cd /builddir/build/BUILD + '[' /builddir/build/BUILDROOT/bowtie-1.3.1-3.fc40.riscv64 '!=' / ']' + rm -rf /builddir/build/BUILDROOT/bowtie-1.3.1-3.fc40.riscv64 ++ dirname /builddir/build/BUILDROOT/bowtie-1.3.1-3.fc40.riscv64 + mkdir -p /builddir/build/BUILDROOT + mkdir /builddir/build/BUILDROOT/bowtie-1.3.1-3.fc40.riscv64 + CFLAGS='-O2 -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Werror=implicit-function-declaration -Werror=implicit-int -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -Wp,-D_GLIBCXX_ASSERTIONS -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -fasynchronous-unwind-tables -fno-omit-frame-pointer ' + export CFLAGS + CXXFLAGS='-O2 -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -Wp,-D_GLIBCXX_ASSERTIONS -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -fasynchronous-unwind-tables -fno-omit-frame-pointer ' + export CXXFLAGS + FFLAGS='-O2 -fexceptions -g -grecord-gcc-switches -pipe -Wall -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -Wp,-D_GLIBCXX_ASSERTIONS -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -fasynchronous-unwind-tables -fno-omit-frame-pointer -I/usr/lib64/gfortran/modules ' + export FFLAGS + FCFLAGS='-O2 -fexceptions -g -grecord-gcc-switches -pipe -Wall -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -Wp,-D_GLIBCXX_ASSERTIONS -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -fasynchronous-unwind-tables -fno-omit-frame-pointer -I/usr/lib64/gfortran/modules ' + export FCFLAGS + VALAFLAGS=-g + export VALAFLAGS + RUSTFLAGS='-Copt-level=3 -Cdebuginfo=2 -Ccodegen-units=1 -Cstrip=none -Cforce-frame-pointers=yes -Clink-arg=-Wl,-z,relro -Clink-arg=-Wl,-z,now -Clink-arg=-specs=/usr/lib/rpm/redhat/redhat-package-notes --cap-lints=warn' + export RUSTFLAGS + LDFLAGS='-Wl,-z,relro -Wl,--as-needed -Wl,-z,now -specs=/usr/lib/rpm/redhat/redhat-hardened-ld -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -Wl,--build-id=sha1 -specs=/usr/lib/rpm/redhat/redhat-package-notes ' + export LDFLAGS + LT_SYS_LIBRARY_PATH=/usr/lib64: + export LT_SYS_LIBRARY_PATH + CC=gcc + export CC + CXX=g++ + export CXX + cd bowtie-1.3.1-src + /usr/bin/make install DESTDIR=/builddir/build/BUILDROOT/bowtie-1.3.1-3.fc40.riscv64 'INSTALL=/usr/bin/install -p' prefix=/usr mkdir -p /builddir/build/BUILDROOT/bowtie-1.3.1-3.fc40.riscv64/usr/bin for file in bowtie-build-s bowtie-build-l bowtie-align-s bowtie-align-l bowtie-inspect-s bowtie-inspect-l bowtie-inspect bowtie-build bowtie ; do \ cp -f $file /builddir/build/BUILDROOT/bowtie-1.3.1-3.fc40.riscv64/usr/bin ; \ done + mkdir -p /builddir/build/BUILDROOT/bowtie-1.3.1-3.fc40.riscv64//usr/share/bowtie + cp -a reads /builddir/build/BUILDROOT/bowtie-1.3.1-3.fc40.riscv64//usr/share/bowtie/ + cp -a indexes /builddir/build/BUILDROOT/bowtie-1.3.1-3.fc40.riscv64//usr/share/bowtie/ + cp -a genomes /builddir/build/BUILDROOT/bowtie-1.3.1-3.fc40.riscv64//usr/share/bowtie/ + cp -a scripts /builddir/build/BUILDROOT/bowtie-1.3.1-3.fc40.riscv64//usr/share/bowtie/ + for cmd in bowtie-*-debug + cp -p bowtie-align-l-debug /builddir/build/BUILDROOT/bowtie-1.3.1-3.fc40.riscv64//usr/bin/ + for cmd in bowtie-*-debug + cp -p bowtie-align-s-debug /builddir/build/BUILDROOT/bowtie-1.3.1-3.fc40.riscv64//usr/bin/ + for cmd in bowtie-*-debug + cp -p bowtie-build-l-debug /builddir/build/BUILDROOT/bowtie-1.3.1-3.fc40.riscv64//usr/bin/ + for cmd in bowtie-*-debug + cp -p bowtie-build-s-debug /builddir/build/BUILDROOT/bowtie-1.3.1-3.fc40.riscv64//usr/bin/ + for cmd in bowtie-*-debug + cp -p bowtie-inspect-l-debug /builddir/build/BUILDROOT/bowtie-1.3.1-3.fc40.riscv64//usr/bin/ + for cmd in bowtie-*-debug + cp -p bowtie-inspect-s-debug /builddir/build/BUILDROOT/bowtie-1.3.1-3.fc40.riscv64//usr/bin/ + /usr/bin/find-debuginfo -j64 --strict-build-id -m -i --build-id-seed 1.3.1-3.fc40 --unique-debug-suffix -1.3.1-3.fc40.riscv64 --unique-debug-src-base bowtie-1.3.1-3.fc40.riscv64 --run-dwz --dwz-low-mem-die-limit 10000000 --dwz-max-die-limit 50000000 -S debugsourcefiles.list /builddir/build/BUILD/bowtie-1.3.1-src find-debuginfo: starting Extracting debug info from 12 files DWARF-compressing 12 files sepdebugcrcfix: Updated 12 CRC32s, 0 CRC32s did match. Creating .debug symlinks for symlinks to ELF files Copying sources found by 'debugedit -l' to /usr/src/debug/bowtie-1.3.1-3.fc40.riscv64 2930 blocks find-debuginfo: done + /usr/lib/rpm/check-buildroot + /usr/lib/rpm/redhat/brp-ldconfig + /usr/lib/rpm/brp-compress + /usr/lib/rpm/redhat/brp-strip-lto /usr/bin/strip + /usr/lib/rpm/brp-strip-static-archive /usr/bin/strip + /usr/lib/rpm/check-rpaths + /usr/lib/rpm/redhat/brp-mangle-shebangs mangling shebang in /usr/share/bowtie/scripts/make_d_melanogaster.sh from /bin/sh to #!/usr/bin/sh mangling shebang in /usr/share/bowtie/scripts/make_canFam2.sh from /bin/sh to #!/usr/bin/sh mangling shebang in /usr/share/bowtie/scripts/make_mm8.sh from /bin/sh to #!/usr/bin/sh mangling shebang in /usr/share/bowtie/scripts/make_mm9.sh from /bin/sh to #!/usr/bin/sh mangling shebang in /usr/share/bowtie/scripts/make_h_sapiens_ncbi36.sh from /bin/sh to #!/usr/bin/sh mangling shebang in /usr/share/bowtie/scripts/make_c_elegans.sh from /bin/sh to #!/usr/bin/sh mangling shebang in /usr/share/bowtie/scripts/make_s_cerevisiae.sh from /bin/sh to #!/usr/bin/sh mangling shebang in /usr/share/bowtie/scripts/make_hg19.sh from /bin/sh to #!/usr/bin/sh mangling shebang in /usr/share/bowtie/scripts/run-hbb.sh from /bin/sh to #!/usr/bin/sh mangling shebang in /usr/share/bowtie/scripts/bowtie-hbb.sh from /bin/bash to #!/usr/bin/bash mangling shebang in /usr/share/bowtie/scripts/make_e_coli.sh from /bin/sh to #!/usr/bin/sh mangling shebang in /usr/share/bowtie/scripts/make_hg18.sh from /bin/sh to #!/usr/bin/sh mangling shebang in /usr/share/bowtie/scripts/make_b_taurus_UMD3.sh from /bin/sh to #!/usr/bin/sh mangling shebang in /usr/share/bowtie/scripts/make_a_thaliana_tair.sh from /bin/sh to #!/usr/bin/sh mangling shebang in /usr/share/bowtie/scripts/make_rn4.sh from /bin/sh to #!/usr/bin/sh mangling shebang in /usr/share/bowtie/scripts/make_m_musculus_ncbi37.sh from /bin/sh to #!/usr/bin/sh mangling shebang in /usr/share/bowtie/scripts/make_galGal3.sh from /bin/sh to #!/usr/bin/sh mangling shebang in /usr/share/bowtie/scripts/build_test.sh from /bin/sh to #!/usr/bin/sh mangling shebang in /usr/share/bowtie/scripts/make_h_sapiens_ncbi37.sh from /bin/sh to #!/usr/bin/sh + /usr/lib/rpm/brp-remove-la-files + env /usr/lib/rpm/redhat/brp-python-bytecompile '' 1 0 -j64 + /usr/lib/rpm/redhat/brp-python-hardlink Executing(%check): /bin/sh -e /var/tmp/rpm-tmp.5UvhBr + umask 022 + cd /builddir/build/BUILD + CFLAGS='-O2 -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Werror=implicit-function-declaration -Werror=implicit-int -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -Wp,-D_GLIBCXX_ASSERTIONS -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -fasynchronous-unwind-tables -fno-omit-frame-pointer ' + export CFLAGS + CXXFLAGS='-O2 -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -Wp,-D_GLIBCXX_ASSERTIONS -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -fasynchronous-unwind-tables -fno-omit-frame-pointer ' + export CXXFLAGS + FFLAGS='-O2 -fexceptions -g -grecord-gcc-switches -pipe -Wall -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -Wp,-D_GLIBCXX_ASSERTIONS -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -fasynchronous-unwind-tables -fno-omit-frame-pointer -I/usr/lib64/gfortran/modules ' + export FFLAGS + FCFLAGS='-O2 -fexceptions -g -grecord-gcc-switches -pipe -Wall -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -Wp,-D_GLIBCXX_ASSERTIONS -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -fasynchronous-unwind-tables -fno-omit-frame-pointer -I/usr/lib64/gfortran/modules ' + export FCFLAGS + VALAFLAGS=-g + export VALAFLAGS + RUSTFLAGS='-Copt-level=3 -Cdebuginfo=2 -Ccodegen-units=1 -Cstrip=none -Cforce-frame-pointers=yes -Clink-arg=-Wl,-z,relro -Clink-arg=-Wl,-z,now -Clink-arg=-specs=/usr/lib/rpm/redhat/redhat-package-notes --cap-lints=warn' + export RUSTFLAGS + LDFLAGS='-Wl,-z,relro -Wl,--as-needed -Wl,-z,now -specs=/usr/lib/rpm/redhat/redhat-hardened-ld -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -Wl,--build-id=sha1 -specs=/usr/lib/rpm/redhat/redhat-package-notes ' + export LDFLAGS + LT_SYS_LIBRARY_PATH=/usr/lib64: + export LT_SYS_LIBRARY_PATH + CC=gcc + export CC + CXX=g++ + export CXX + cd bowtie-1.3.1-src + for cmd in bowtie bowtie-build bowtie-inspect + ./bowtie --version + grep 'version 1.3.1' /builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s version 1.3.1 + for cmd in bowtie bowtie-build bowtie-inspect + ./bowtie-build --version + grep 'version 1.3.1' bowtie-build version 1.3.1 + for cmd in bowtie bowtie-build bowtie-inspect + ./bowtie-inspect --version + grep 'version 1.3.1' bowtie-inspect version 1.3.1 + tar xzvf /builddir/build/SOURCES/bowtie-1.3.1-tests.tgz scripts/test/ scripts/test/random_bowtie_tests_p.sh scripts/test/samtools.pl scripts/test/simple_tests.pl scripts/test/cs_dec.pl scripts/test/random_bowtie_tests.sh scripts/test/btface.py scripts/test/long_read.pl scripts/test/dataface.py scripts/test/inspect.pl scripts/test/random_bowtie_tests.pl scripts/test/args.pl scripts/test/DNA.pm scripts/test/big_data/ scripts/test/big_data/reads/ scripts/test/big_data/reads/human_reads.fa scripts/test/big_data/reads/mouse_reads.fa scripts/test/cs_trim.pl scripts/test/btdata.py scripts/test/build_big.py scripts/test/large_idx.py scripts/test/all.sh + cat /builddir/build/SOURCES/bowtie-test-remove-perl-Sys-Info-dep.patch + patch -p1 patching file scripts/test/simple_tests.pl + scripts/test/simple_tests.pl --bowtie=./bowtie --bowtie-build=./bowtie-build FASTA-continuous 1 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie-build --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug -F 10,9 -S --quiet -a .simple_tests.tmp .simple_tests Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -F 10,9 -S --quiet -a .simple_tests.tmp .simple_tests" seq1_0 0 0 1 255 10M * 0 0 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 seq1_9 0 0 10 255 10M * 0 0 CAGTATCTGA IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 # reads processed: 2 # reads with at least one alignment: 2 (100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments FASTA-continuous 2 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug -F 10,9 -S --quiet -a .simple_tests.tmp .simple_tests Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -F 10,9 -S --quiet -a .simple_tests.tmp .simple_tests" seq1_0 0 0 1 255 10M * 0 0 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 seq2_0 0 0 1 255 10M * 0 0 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 seq2_9 0 0 10 255 10M * 0 0 CAGTATCTGA IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 # reads processed: 3 # reads with at least one alignment: 3 (100.00%) # reads that failed to align: 0 (0.00%) Reported 3 alignments FASTA-continuous 3 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug -F 10,9 -u 1 -S --quiet -a .simple_tests.tmp .simple_tests Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -F 10,9 -u 1 -S --quiet -a .simple_tests.tmp .simple_tests" seq1_0 0 0 1 255 10M * 0 0 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments FASTA-continuous 4 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug -F 10,9 -s 1 -S --quiet -a .simple_tests.tmp .simple_tests Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -F 10,9 -s 1 -S --quiet -a .simple_tests.tmp .simple_tests" seq1_9 0 0 10 255 10M * 0 0 CAGTATCTGA IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments FASTA-continuous 5 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug -F 10,9 -u 1 -s 1 -S --quiet -a .simple_tests.tmp .simple_tests Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -F 10,9 -u 1 -s 1 -S --quiet -a .simple_tests.tmp .simple_tests" seq2_0 0 0 1 255 10M * 0 0 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments FASTA-continuous 6 (fw:1, sam:1) References: >0 AGCATCGATCAG ./bowtie-build --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug -F 10,1 -S --quiet -a .simple_tests.tmp .simple_tests Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 3 # reads with at least one alignment: 3 (100.00%) # reads that failed to align: 0 (0.00%) Reported 3 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:12 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -F 10,1 -S --quiet -a .simple_tests.tmp .simple_tests" seq1_0 0 0 1 255 10M * 0 0 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 seq1_1 0 0 2 255 10M * 0 0 GCATCGATCA IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 seq1_2 0 0 3 255 10M * 0 0 CATCGATCAG IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 Cline 7 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie-build --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug --trim3 4 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 --trim3 4 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII" 0 0 0 3 255 12M * 0 0 CATCGATCAGTA IIIIIIIIIIII XA:i:0 MD:Z:12 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Cline 8 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug --trim5 16 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 --trim5 16 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII" 0 4 * 0 0 * * 0 0 XM:i:0 Cline 9 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug -s 1 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII" # reads processed: 0 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 0 (0.00%) No alignments Cline multiread 2 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug -u 1 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII,ATCGATCAGTATCTG:IIIIIIIIIIIIIII Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII,ATCGATCAGTATCTG:IIIIIIIIIIIIIII" 0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Cline multiread 3 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug -u 2 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG,ATCGATCAGTATCTG Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -u 2 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG,ATCGATCAGTATCTG" 0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 1 0 0 4 255 15M * 0 0 ATCGATCAGTATCTG IIIIIIIIIIIIIII XA:i:0 MD:Z:15 NM:i:0 XM:i:1 # reads processed: 2 # reads with at least one alignment: 2 (100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments Cline paired 2 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie-build --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug -s 1 -S --quiet -a .simple_tests.tmp -c -1 AGCATCGATC:IIIIIIIIII,TCAGTTTTTGA:IIIIIIIIIII -2 TCAGTTTTTGA:IIIIIIIIIII,AGCATCGATC:IIIIIIIIII Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -c -1 AGCATCGATC:IIIIIIIIII,TCAGTTTTTGA:IIIIIIIIIII -2 TCAGTTTTTGA:IIIIIIIIIII,AGCATCGATC:IIIIIIIIII" 1 163 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 1 83 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Cline paired 3 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --debug -u 1 -S --quiet -a .simple_tests.tmp -c -1 AGCATCGATC:IIIIIIIIII,TCAGTTTTTGA:IIIIIIIIIII -2 TCAGTTTTTGA:IIIIIIIIIII,AGCATCGATC:IIIIIIIIII Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -c -1 AGCATCGATC:IIIIIIIIII,TCAGTTTTTGA:IIIIIIIIIII -2 TCAGTTTTTGA:IIIIIIIIIII,AGCATCGATC:IIIIIIIIII" 0 99 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 0 147 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 Cline paired 4 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --debug -3 7 -S --quiet -a .simple_tests.tmp -c -1 AGCATCG:IIIIIII -2 GATCAAAAACTGA:IIIIIIIIIIIII Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -3 7 -S --quiet -a .simple_tests.tmp -c -1 AGCATCG:IIIIIII -2 GATCAAAAACTGA:IIIIIIIIIIIII" 0 77 * 0 0 * * 0 0 XM:i:0 0 141 * 0 0 * * 0 0 GATCAA IIIIII XM:i:0 100.00%) No alignments Fastq 7 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie-build --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug --trim3 4 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 --trim3 4 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq" r0 0 0 3 255 12M * 0 0 CATCGATCAGTA IIIIIIIIIIII XA:i:0 MD:Z:12 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Fastq 8 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug --trim5 16 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 --trim5 16 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq" r0 4 * 0 0 * * 0 0 XM:i:0 # reads processed: 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments Fastq 9 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug -s 1 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq" # reads processed: 0 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 0 (0.00%) No alignments Fastq multiread 2 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug -u 1 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq" r0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Fastq multiread 3 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug -u 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -u 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq" r0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 r1 0 0 4 255 15M * 0 0 ATCGATCAGTATCTG IIIIIIIIIIIIIII XA:i:0 MD:Z:15 NM:i:0 XM:i:1 # reads processed: 2 # reads with at least one alignment: 2 (100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments Fastq paired 2 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie-build --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug -s 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r1 163 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 r1 83 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Fastq paired 3 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --debug -u 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 r0 147 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Fastq paired 4 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --debug -3 7 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -3 7 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 77 * 0 0 * * 0 0 XM:i:0 r0 141 * 0 0 * * 0 0 GATCAA IIIIII XM:i:0 # reads processed: 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments Fasta 7 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie-build --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug --trim3 4 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 --trim3 4 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa" r0 0 0 3 255 12M * 0 0 CATCGATCAGTA IIIIIIIIIIII XA:i:0 MD:Z:12 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Fasta 8 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug --trim3 16 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 --trim3 16 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa" r0 4 * 0 0 * * 0 0 XM:i:0 # reads processed: 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments Fasta 9 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug -s 1 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa" # reads processed: 0 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 0 (0.00%) No alignments Fasta multiread 2 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug -u 1 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa" r0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 0.00%) Reported 1 alignments Fasta multiread 3 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug -u 2 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -u 2 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa" r0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 r1 0 0 4 255 15M * 0 0 ATCGATCAGTATCTG IIIIIIIIIIIIIII XA:i:0 MD:Z:15 NM:i:0 XM:i:1 # reads processed: 2 # reads with at least one alignment: 2 (100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments Fasta paired 2 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie-build --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug -s 1 -S --quiet -a .simple_tests.tmp -f -1 .simple_tests.1.fa -2 .simple_tests.2.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -f -1 .simple_tests.1.fa -2 .simple_tests.2.fa" r1 163 0 1 255 9M = 9 19 AGCATCGAT IIIIIIIII XA:i:0 MD:Z:9 NM:i:0 XM:i:1 r1 83 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 Fasta paired 3 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --debug -u 1 -S --quiet -a .simple_tests.tmp -f -1 .simple_tests.1.fa -2 .simple_tests.2.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -f -1 .simple_tests.1.fa -2 .simple_tests.2.fa" r0 99 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 r0 147 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 Fasta paired 4 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --debug -3 7 -S --quiet -a .simple_tests.tmp -f -1 .simple_tests.1.fa -2 .simple_tests.2.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -3 7 -S --quiet -a .simple_tests.tmp -f -1 .simple_tests.1.fa -2 .simple_tests.2.fa" 0 77 * 0 0 * * 0 0 XM:i:0 0 141 * 0 0 * * 0 0 GATCAA IIIIII XM:i:0 100.00%) No alignments Raw 7 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie-build --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug --trim3 4 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 --trim3 4 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw" 0 0 0 3 255 12M * 0 0 CATCGATCAGTA IIIIIIIIIIII XA:i:0 MD:Z:12 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Raw 8 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug --trim3 16 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 --trim3 16 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw" 0 4 * 0 0 * * 0 0 XM:i:0 # reads processed: 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments Raw 9 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug -s 1 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 0 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 0 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw" 0.00%) No alignments Raw multiread 2 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug -u 1 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw" 0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Raw multiread 3 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug -u 2 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 2 # reads with at least one alignment: 2 (100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -u 2 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw" 0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 1 0 0 4 255 15M * 0 0 ATCGATCAGTATCTG IIIIIIIIIIIIIII XA:i:0 MD:Z:15 NM:i:0 XM:i:1 Raw paired 2 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie-build --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug -s 1 -S --quiet -a .simple_tests.tmp -r -1 .simple_tests.1.raw -2 .simple_tests.2.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -r -1 .simple_tests.1.raw -2 .simple_tests.2.raw" 1 163 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 1 83 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 Raw paired 3 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --debug -u 1 -S --quiet -a .simple_tests.tmp -r -1 .simple_tests.1.raw -2 .simple_tests.2.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -r -1 .simple_tests.1.raw -2 .simple_tests.2.raw" 0 99 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 0 147 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 Raw paired 4 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --debug -3 7 -S --quiet -a .simple_tests.tmp -r -1 .simple_tests.1.raw -2 .simple_tests.2.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -3 7 -S --quiet -a .simple_tests.tmp -r -1 .simple_tests.1.raw -2 .simple_tests.2.raw" 0 77 * 0 0 * * 0 0 XM:i:0 0 141 * 0 0 * * 0 0 GATCAA IIIIII XM:i:0 # reads processed: 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments Tabbed 7 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie-build --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug --trim3 4 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 --trim3 4 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r0 0 0 3 255 12M * 0 0 CATCGATCAGTA IIIIIIIIIIII XA:i:0 MD:Z:12 NM:i:0 XM:i:1 Tabbed 8 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug --trim5 16 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted # reads processed: 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 --trim5 16 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r0 4 * 0 0 * * 0 0 XM:i:0 Tabbed 9 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug -s 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" # reads processed: 0 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 0 (0.00%) No alignments Tabbed multiread 2 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug -u 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Tabbed multiread 3 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug -u 2 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 # reads processed: 2 # reads with at least one alignment: 2 (100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -u 2 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 r1 0 0 4 255 15M * 0 0 ATCGATCAGTATCTG IIIIIIIIIIIIIII XA:i:0 MD:Z:15 NM:i:0 XM:i:1 Tabbed paired 2 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie-build --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug -s 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r1 163 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 r1 83 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Tabbed paired 3 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --debug -u 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r0 99 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 r0 147 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Tabbed paired 4 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --debug -3 7 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -3 7 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r0 77 * 0 0 * * 0 0 XM:i:0 r0 141 * 0 0 * * 0 0 GATCAA IIIIII XM:i:0 # reads processed: 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments Interleaved 1 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie-build --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug -v 0 -S --quiet -a .simple_tests.tmp --interleaved .simple_tests.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp --interleaved .simple_tests.fq" r0 99 0 3 255 8M = 17 21 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 17 255 7M = 3 -21 TAGATGG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 1 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 17 21 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 17 255 7M = 3 -21 TAGATGG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 Paired-end 1 (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 17 21 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 17 255 7M = 3 -21 TAGATGG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 Paired-end 1 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 17 21 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 17 255 7M = 3 -21 TAGATGG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 1 (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 17 21 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 17 255 7M = 3 -21 TAGATGG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 2 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 12 16 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 12 255 7M = 3 -16 TTTTATA IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 2 (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 12 16 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 12 255 7M = 3 -16 TTTTATA IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 Paired-end 2 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 12 16 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 12 255 7M = 3 -16 TTTTATA IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 2 (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 12 16 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 12 255 7M = 3 -16 TTTTATA IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 3 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 8 12 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 8 255 7M = 3 -12 AAGCTTT IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 Paired-end 3 (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 8 12 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 8 255 7M = 3 -12 AAGCTTT IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 Paired-end 3 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 8 12 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 8 255 7M = 3 -12 AAGCTTT IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 Paired-end 3 (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 8 12 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 8 255 7M = 3 -12 AAGCTTT IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 4, containment excluded (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 77 * 0 0 * * 0 0 AACGAAAG IIIIIIII XM:i:0 r0 141 * 0 0 * * 0 0 CTTTCGT IIIIIII XM:i:0 # reads processed: 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments Paired-end 4, containment excluded (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 77 * 0 0 * * 0 0 CTTTCGT IIIIIII XM:i:0 r0 141 * 0 0 * * 0 0 AACGAAAG IIIIIIII XM:i:0 Paired-end 4, containment excluded (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 77 * 0 0 * * 0 0 AACGAAAG IIIIIIII XM:i:0 r0 141 * 0 0 * * 0 0 CTTTCGT IIIIIII XM:i:0 # reads processed: 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments Paired-end 4, containment excluded (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 77 * 0 0 * * 0 0 CTTTCGT IIIIIII XM:i:0 r0 141 * 0 0 * * 0 0 AACGAAAG IIIIIIII XM:i:0 # reads processed: 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments Paired-end 5, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 4 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 4 255 7M = 3 -8 ACGAAAG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 5, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 4 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 4 255 7M = 3 -8 ACGAAAG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 5, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 4 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 4 255 7M = 3 -8 ACGAAAG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 5, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 4 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 4 255 7M = 3 -8 ACGAAAG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 Paired-end 6, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 Paired-end 6, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 Paired-end 6, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 Paired-end 6, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 Paired-end 7, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --allow-contain -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 --allow-contain -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 Paired-end 7, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --allow-contain -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 --allow-contain -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 Paired-end 7, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --allow-contain -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 --allow-contain -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 0.00%) Reported 1 paired-end alignments Paired-end 7, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --allow-contain -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 --allow-contain -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 8, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --allow-contain --ff -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 --allow-contain --ff -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 131 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 8, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --allow-contain --ff -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 --allow-contain --ff -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 131 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 Paired-end 8, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --allow-contain --ff -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 --allow-contain --ff -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 131 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 8, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --allow-contain --ff -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 --allow-contain --ff -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 131 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 9, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --allow-contain --ff -v 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 --allow-contain --ff -v 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 131 0 3 255 8M = 3 8 AACGATAG IIIIIIII XA:i:1 MD:Z:5A2 NM:i:1 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 9, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --allow-contain --ff -v 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 --allow-contain --ff -v 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGATAG IIIIIIII XA:i:1 MD:Z:5A2 NM:i:1 XM:i:1 r0 131 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 9, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --allow-contain --ff -n 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 --allow-contain --ff -n 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 131 0 3 255 8M = 3 8 AACGATAG IIIIIIII XA:i:1 MD:Z:5A2 NM:i:1 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 9, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --allow-contain --ff -n 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 --allow-contain --ff -n 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGATAG IIIIIIII XA:i:1 MD:Z:5A2 NM:i:1 XM:i:1 r0 131 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Checking -m, 1 (fw:1, sam:1) References: >0 TTGTTCGTTTGTTCGT ./bowtie-build --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:16 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 0 0 9 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 Checking -m, 1 (fw:0, sam:1) References: >0 TTGTTCGTTTGTTCGT ./bowtie --debug -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:16 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 9 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 16 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments Checking -m, 1 (fw:1, sam:1) References: >0 TTGTTCGTTTGTTCGT ./bowtie-build --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:16 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 0 0 9 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 Checking -m, 1 (fw:0, sam:1) References: >0 TTGTTCGTTTGTTCGT ./bowtie --debug -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:16 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 9 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 16 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 Checking -m, 2 (fw:1, sam:1) References: >0 TTGTTCGTTTGTTCGTTTGTTCGT ./bowtie-build --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:24 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) # reads with alignments suppressed due to -m: 1 (100.00%) No alignments Checking -m, 2 (fw:0, sam:1) References: >0 TTGTTCGTTTGTTCGTTTGTTCGT ./bowtie --debug -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:24 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" 0.00%) # reads with alignments suppressed due to -m: 1 (100.00%) No alignments Checking -m, 2 (fw:1, sam:1) References: >0 TTGTTCGTTTGTTCGTTTGTTCGT ./bowtie-build --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:24 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) # reads with alignments suppressed due to -m: 1 (100.00%) No alignments Checking -m, 2 (fw:0, sam:1) References: >0 TTGTTCGTTTGTTCGTTTGTTCGT ./bowtie --debug -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:24 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) # reads with alignments suppressed due to -m: 1 (100.00%) No alignments Checking edits 1 (fw:1, sam:1) References: >0 TTGCCCGT ./bowtie-build --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:2 MD:Z:3C0C3 NM:i:2 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Checking edits 1 (fw:0, sam:1) References: >0 TTGCCCGT ./bowtie --debug -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:2 MD:Z:3C0C3 NM:i:2 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Checking edits 1 (fw:1, sam:1) References: >0 TTGCCCGT ./bowtie-build --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:2 MD:Z:3C0C3 NM:i:2 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Checking edits 1 (fw:0, sam:1) References: >0 TTGCCCGT ./bowtie --debug -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:2 MD:Z:3C0C3 NM:i:2 XM:i:1 Checking edits 2 (fw:1, sam:1) References: >0 TTGTTCGT ./bowtie-build --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 1 255 8M * 0 0 TTGCCCGT IIIIIIII XA:i:2 MD:Z:3T0T3 NM:i:2 XM:i:1 Checking edits 2 (fw:0, sam:1) References: >0 TTGTTCGT ./bowtie --debug -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 1 255 8M * 0 0 TTGCCCGT IIIIIIII XA:i:2 MD:Z:3T0T3 NM:i:2 XM:i:1 Checking edits 2 (fw:1, sam:1) References: >0 TTGTTCGT ./bowtie-build --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 1 255 8M * 0 0 TTGCCCGT IIIIIIII XA:i:2 MD:Z:3T0T3 NM:i:2 XM:i:1 0.00%) Reported 1 alignments Checking edits 2 (fw:0, sam:1) References: >0 TTGTTCGT ./bowtie --debug -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 1 255 8M * 0 0 TTGCCCGT IIIIIIII XA:i:2 MD:Z:3T0T3 NM:i:2 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Checking edits 3 (fw:1, sam:1) References: >0 ACGTTCGT ./bowtie-build --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug -v 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 3 255 4M * 0 0 GTTC IIII XA:i:0 MD:Z:4 NM:i:0 XM:i:1 Checking edits 3 (fw:0, sam:1) References: >0 ACGTTCGT ./bowtie --debug -v 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 3 255 4M * 0 0 GTTC IIII XA:i:0 MD:Z:4 NM:i:0 XM:i:1 Checking edits 3 (fw:1, sam:1) References: >0 ACGTTCGT ./bowtie-build --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug -n 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 3 255 4M * 0 0 GTTC IIII XA:i:0 MD:Z:4 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Checking edits 3 (fw:0, sam:1) References: >0 ACGTTCGT ./bowtie --debug -n 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 3 255 4M * 0 0 GTTC IIII XA:i:0 MD:Z:4 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments FASTA-continuous 1 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie-build --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie -F 10,9 -S --quiet -a .simple_tests.tmp .simple_tests Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 2 # reads with at least one alignment: 2 (100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -F 10,9 -S --quiet -a .simple_tests.tmp .simple_tests" seq1_0 0 0 1 255 10M * 0 0 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 seq1_9 0 0 10 255 10M * 0 0 CAGTATCTGA IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 FASTA-continuous 2 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie -F 10,9 -S --quiet -a .simple_tests.tmp .simple_tests Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -F 10,9 -S --quiet -a .simple_tests.tmp .simple_tests" seq1_0 0 0 1 255 10M * 0 0 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 # reads processed: 3 # reads with at least one alignment: 3 (100.00%) # reads that failed to align: 0 (0.00%) Reported 3 alignments seq2_0 0 0 1 255 10M * 0 0 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 seq2_9 0 0 10 255 10M * 0 0 CAGTATCTGA IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 FASTA-continuous 3 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie -F 10,9 -u 1 -S --quiet -a .simple_tests.tmp .simple_tests Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -F 10,9 -u 1 -S --quiet -a .simple_tests.tmp .simple_tests" seq1_0 0 0 1 255 10M * 0 0 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments FASTA-continuous 4 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie -F 10,9 -s 1 -S --quiet -a .simple_tests.tmp .simple_tests Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -F 10,9 -s 1 -S --quiet -a .simple_tests.tmp .simple_tests" seq1_9 0 0 10 255 10M * 0 0 CAGTATCTGA IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 FASTA-continuous 5 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie -F 10,9 -u 1 -s 1 -S --quiet -a .simple_tests.tmp .simple_tests Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -F 10,9 -u 1 -s 1 -S --quiet -a .simple_tests.tmp .simple_tests" seq2_0 0 0 1 255 10M * 0 0 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments FASTA-continuous 6 (fw:1, sam:1) References: >0 AGCATCGATCAG ./bowtie-build --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie -F 10,1 -S --quiet -a .simple_tests.tmp .simple_tests Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:12 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -F 10,1 -S --quiet -a .simple_tests.tmp .simple_tests" seq1_0 0 0 1 255 10M * 0 0 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 seq1_1 0 0 2 255 10M * 0 0 GCATCGATCA IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 seq1_2 0 0 3 255 10M * 0 0 CATCGATCAG IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 # reads processed: 3 # reads with at least one alignment: 3 (100.00%) # reads that failed to align: 0 (0.00%) Reported 3 alignments Cline 7 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie-build --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --trim3 4 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 --trim3 4 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII" 0 0 0 3 255 12M * 0 0 CATCGATCAGTA IIIIIIIIIIII XA:i:0 MD:Z:12 NM:i:0 XM:i:1 Cline 8 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --trim5 16 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted # reads processed: 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 --trim5 16 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII" 0 4 * 0 0 * * 0 0 XM:i:0 Cline 9 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie -s 1 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII" # reads processed: 0 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 0 (0.00%) No alignments Cline multiread 2 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie -u 1 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII,ATCGATCAGTATCTG:IIIIIIIIIIIIIII Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII,ATCGATCAGTATCTG:IIIIIIIIIIIIIII" 0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Cline multiread 3 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie -u 2 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG,ATCGATCAGTATCTG Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -u 2 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG,ATCGATCAGTATCTG" 0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 1 0 0 4 255 15M * 0 0 ATCGATCAGTATCTG IIIIIIIIIIIIIII XA:i:0 MD:Z:15 NM:i:0 XM:i:1 # reads processed: 2 # reads with at least one alignment: 2 (100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments Cline paired 2 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie-build --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie -s 1 -S --quiet -a .simple_tests.tmp -c -1 AGCATCGATC:IIIIIIIIII,TCAGTTTTTGA:IIIIIIIIIII -2 TCAGTTTTTGA:IIIIIIIIIII,AGCATCGATC:IIIIIIIIII Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -c -1 AGCATCGATC:IIIIIIIIII,TCAGTTTTTGA:IIIIIIIIIII -2 TCAGTTTTTGA:IIIIIIIIIII,AGCATCGATC:IIIIIIIIII" 1 163 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 1 83 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Cline paired 3 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie -u 1 -S --quiet -a .simple_tests.tmp -c -1 AGCATCGATC:IIIIIIIIII,TCAGTTTTTGA:IIIIIIIIIII -2 TCAGTTTTTGA:IIIIIIIIIII,AGCATCGATC:IIIIIIIIII Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -c -1 AGCATCGATC:IIIIIIIIII,TCAGTTTTTGA:IIIIIIIIIII -2 TCAGTTTTTGA:IIIIIIIIIII,AGCATCGATC:IIIIIIIIII" 0 99 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 0 147 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Cline paired 4 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie -3 7 -S --quiet -a .simple_tests.tmp -c -1 AGCATCG:IIIIIII -2 GATCAAAAACTGA:IIIIIIIIIIIII Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -3 7 -S --quiet -a .simple_tests.tmp -c -1 AGCATCG:IIIIIII -2 GATCAAAAACTGA:IIIIIIIIIIIII" 0 77 * 0 0 * * 0 0 XM:i:0 0 141 * 0 0 * * 0 0 GATCAA IIIIII XM:i:0 Fastq 7 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie-build --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --trim3 4 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 --trim3 4 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq" r0 0 0 3 255 12M * 0 0 CATCGATCAGTA IIIIIIIIIIII XA:i:0 MD:Z:12 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Fastq 8 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --trim5 16 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 --trim5 16 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq" r0 4 * 0 0 * * 0 0 XM:i:0 # reads processed: 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments Fastq 9 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie -s 1 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq" # reads processed: 0 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 0 (0.00%) No alignments Fastq multiread 2 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie -u 1 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq" r0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Fastq multiread 3 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie -u 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 2 # reads with at least one alignment: 2 (100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -u 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq" r0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 r1 0 0 4 255 15M * 0 0 ATCGATCAGTATCTG IIIIIIIIIIIIIII XA:i:0 MD:Z:15 NM:i:0 XM:i:1 Fastq paired 2 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie-build --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie -s 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r1 163 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 r1 83 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 Fastq paired 3 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie -u 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 r0 147 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 Fastq paired 4 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie -3 7 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -3 7 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 77 * 0 0 * * 0 0 XM:i:0 r0 141 * 0 0 * * 0 0 GATCAA IIIIII XM:i:0 # reads processed: 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments Fasta 7 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie-build --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --trim3 4 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 --trim3 4 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa" r0 0 0 3 255 12M * 0 0 CATCGATCAGTA IIIIIIIIIIII XA:i:0 MD:Z:12 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Fasta 8 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --trim3 16 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 --trim3 16 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa" r0 4 * 0 0 * * 0 0 XM:i:0 # reads processed: 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments Fasta 9 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie -s 1 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa" # reads processed: 0 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 0 (0.00%) No alignments Fasta multiread 2 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie -u 1 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa" r0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Fasta multiread 3 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie -u 2 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -u 2 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa" r0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 # reads processed: 2 # reads with at least one alignment: 2 (100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments r1 0 0 4 255 15M * 0 0 ATCGATCAGTATCTG IIIIIIIIIIIIIII XA:i:0 MD:Z:15 NM:i:0 XM:i:1 Fasta paired 2 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie-build --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie -s 1 -S --quiet -a .simple_tests.tmp -f -1 .simple_tests.1.fa -2 .simple_tests.2.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -f -1 .simple_tests.1.fa -2 .simple_tests.2.fa" r1 163 0 1 255 9M = 9 19 AGCATCGAT IIIIIIIII XA:i:0 MD:Z:9 NM:i:0 XM:i:1 r1 83 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 0.00%) Reported 1 paired-end alignments Fasta paired 3 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie -u 1 -S --quiet -a .simple_tests.tmp -f -1 .simple_tests.1.fa -2 .simple_tests.2.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -f -1 .simple_tests.1.fa -2 .simple_tests.2.fa" r0 99 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 r0 147 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Fasta paired 4 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie -3 7 -S --quiet -a .simple_tests.tmp -f -1 .simple_tests.1.fa -2 .simple_tests.2.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -3 7 -S --quiet -a .simple_tests.tmp -f -1 .simple_tests.1.fa -2 .simple_tests.2.fa" 0 77 * 0 0 * * 0 0 XM:i:0 0 141 * 0 0 * * 0 0 GATCAA IIIIII XM:i:0 # reads processed: 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments Raw 7 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie-build --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --trim3 4 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 --trim3 4 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw" 0 0 0 3 255 12M * 0 0 CATCGATCAGTA IIIIIIIIIIII XA:i:0 MD:Z:12 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Raw 8 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --trim3 16 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 --trim3 16 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw" 0 4 * 0 0 * * 0 0 XM:i:0 # reads processed: 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments Raw 9 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie -s 1 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw" # reads processed: 0 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 0 (0.00%) No alignments Raw multiread 2 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie -u 1 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw" 0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 0.00%) Reported 1 alignments Raw multiread 3 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie -u 2 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -u 2 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw" 0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 1 0 0 4 255 15M * 0 0 ATCGATCAGTATCTG IIIIIIIIIIIIIII XA:i:0 MD:Z:15 NM:i:0 XM:i:1 # reads processed: 2 # reads with at least one alignment: 2 (100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments Raw paired 2 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie-build --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie -s 1 -S --quiet -a .simple_tests.tmp -r -1 .simple_tests.1.raw -2 .simple_tests.2.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -r -1 .simple_tests.1.raw -2 .simple_tests.2.raw" 1 163 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 1 83 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Raw paired 3 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie -u 1 -S --quiet -a .simple_tests.tmp -r -1 .simple_tests.1.raw -2 .simple_tests.2.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -r -1 .simple_tests.1.raw -2 .simple_tests.2.raw" 0 99 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 0 147 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Raw paired 4 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie -3 7 -S --quiet -a .simple_tests.tmp -r -1 .simple_tests.1.raw -2 .simple_tests.2.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -3 7 -S --quiet -a .simple_tests.tmp -r -1 .simple_tests.1.raw -2 .simple_tests.2.raw" 0 77 * 0 0 * * 0 0 XM:i:0 0 141 * 0 0 * * 0 0 GATCAA IIIIII XM:i:0 # reads processed: 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments Tabbed 7 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie-build --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --trim3 4 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 --trim3 4 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r0 0 0 3 255 12M * 0 0 CATCGATCAGTA IIIIIIIIIIII XA:i:0 MD:Z:12 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Tabbed 8 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --trim5 16 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 --trim5 16 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r0 4 * 0 0 * * 0 0 XM:i:0 # reads processed: 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments Tabbed 9 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie -s 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 0 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 0 (0.00%) No alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" Tabbed multiread 2 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie -u 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Tabbed multiread 3 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie -u 2 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -u 2 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 r1 0 0 4 255 15M * 0 0 ATCGATCAGTATCTG IIIIIIIIIIIIIII XA:i:0 MD:Z:15 NM:i:0 XM:i:1 # reads processed: 2 # reads with at least one alignment: 2 (100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments Tabbed paired 2 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie-build --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie -s 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r1 163 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 r1 83 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Tabbed paired 3 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie -u 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r0 99 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 r0 147 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Tabbed paired 4 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie -3 7 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -3 7 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r0 77 * 0 0 * * 0 0 XM:i:0 r0 141 * 0 0 * * 0 0 GATCAA IIIIII XM:i:0 # reads processed: 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments Interleaved 1 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie-build --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie -v 0 -S --quiet -a .simple_tests.tmp --interleaved .simple_tests.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp --interleaved .simple_tests.fq" r0 99 0 3 255 8M = 17 21 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 17 255 7M = 3 -21 TAGATGG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 Paired-end 1 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 17 21 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 17 255 7M = 3 -21 TAGATGG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 1 (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 17 21 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 17 255 7M = 3 -21 TAGATGG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 1 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 17 21 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 17 255 7M = 3 -21 TAGATGG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 1 (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 17 21 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 17 255 7M = 3 -21 TAGATGG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 Paired-end 2 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 12 16 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 12 255 7M = 3 -16 TTTTATA IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 Paired-end 2 (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 12 16 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 12 255 7M = 3 -16 TTTTATA IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 Paired-end 2 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 12 16 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 12 255 7M = 3 -16 TTTTATA IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 Paired-end 2 (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 12 16 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 12 255 7M = 3 -16 TTTTATA IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 Paired-end 3 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 8 12 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 8 255 7M = 3 -12 AAGCTTT IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 3 (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 8 12 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 8 255 7M = 3 -12 AAGCTTT IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 3 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 8 12 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 8 255 7M = 3 -12 AAGCTTT IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 3 (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 8 12 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 8 255 7M = 3 -12 AAGCTTT IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 4, containment excluded (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 77 * 0 0 * * 0 0 AACGAAAG IIIIIIII XM:i:0 r0 141 * 0 0 * * 0 0 CTTTCGT IIIIIII XM:i:0 Paired-end 4, containment excluded (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 77 * 0 0 * * 0 0 CTTTCGT IIIIIII XM:i:0 r0 141 * 0 0 * * 0 0 AACGAAAG IIIIIIII XM:i:0 # reads processed: 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments Paired-end 4, containment excluded (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 77 * 0 0 * * 0 0 AACGAAAG IIIIIIII XM:i:0 r0 141 * 0 0 * * 0 0 CTTTCGT IIIIIII XM:i:0 # reads processed: 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments Paired-end 4, containment excluded (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 77 * 0 0 * * 0 0 CTTTCGT IIIIIII XM:i:0 r0 141 * 0 0 * * 0 0 AACGAAAG IIIIIIII XM:i:0 # reads processed: 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments Paired-end 5, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 4 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 4 255 7M = 3 -8 ACGAAAG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 5, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 4 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 4 255 7M = 3 -8 ACGAAAG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 5, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 4 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 4 255 7M = 3 -8 ACGAAAG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 5, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 4 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 4 255 7M = 3 -8 ACGAAAG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 Paired-end 6, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 Paired-end 6, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 6, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 6, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 7, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --allow-contain -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 --allow-contain -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 7, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --allow-contain -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 --allow-contain -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 7, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --allow-contain -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 --allow-contain -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 7, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --allow-contain -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 --allow-contain -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 8, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --allow-contain --ff -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 --allow-contain --ff -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 131 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 0.00%) Reported 1 paired-end alignments Paired-end 8, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --allow-contain --ff -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 --allow-contain --ff -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 131 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 0.00%) Reported 1 paired-end alignments Paired-end 8, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --allow-contain --ff -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 --allow-contain --ff -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 131 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 Paired-end 8, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --allow-contain --ff -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 --allow-contain --ff -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 131 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 9, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --allow-contain --ff -v 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 --allow-contain --ff -v 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 131 0 3 255 8M = 3 8 AACGATAG IIIIIIII XA:i:1 MD:Z:5A2 NM:i:1 XM:i:1 Paired-end 9, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --allow-contain --ff -v 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 --allow-contain --ff -v 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGATAG IIIIIIII XA:i:1 MD:Z:5A2 NM:i:1 XM:i:1 r0 131 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 9, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --allow-contain --ff -n 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 --allow-contain --ff -n 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 131 0 3 255 8M = 3 8 AACGATAG IIIIIIII XA:i:1 MD:Z:5A2 NM:i:1 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 9, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --allow-contain --ff -n 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 --allow-contain --ff -n 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGATAG IIIIIIII XA:i:1 MD:Z:5A2 NM:i:1 XM:i:1 r0 131 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 Checking -m, 1 (fw:1, sam:1) References: >0 TTGTTCGTTTGTTCGT ./bowtie-build --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:16 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 0 0 9 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 Checking -m, 1 (fw:0, sam:1) References: >0 TTGTTCGTTTGTTCGT ./bowtie -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:16 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 9 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 16 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments Checking -m, 1 (fw:1, sam:1) References: >0 TTGTTCGTTTGTTCGT ./bowtie-build --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) @HD VN:1.0 SO:unsorted @SQ SN:0 LN:16 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 0 0 9 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 Reported 2 alignments Checking -m, 1 (fw:0, sam:1) References: >0 TTGTTCGTTTGTTCGT ./bowtie -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:16 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 9 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 16 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments Checking -m, 2 (fw:1, sam:1) References: >0 TTGTTCGTTTGTTCGTTTGTTCGT ./bowtie-build --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) # reads with alignments suppressed due to -m: 1 (100.00%) No alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:24 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" Checking -m, 2 (fw:0, sam:1) References: >0 TTGTTCGTTTGTTCGTTTGTTCGT ./bowtie -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:24 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) # reads with alignments suppressed due to -m: 1 (100.00%) No alignments Checking -m, 2 (fw:1, sam:1) References: >0 TTGTTCGTTTGTTCGTTTGTTCGT ./bowtie-build --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:24 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) # reads with alignments suppressed due to -m: 1 (100.00%) No alignments Checking -m, 2 (fw:0, sam:1) References: >0 TTGTTCGTTTGTTCGTTTGTTCGT ./bowtie -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:24 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) # reads with alignments suppressed due to -m: 1 (100.00%) No alignments Checking edits 1 (fw:1, sam:1) References: >0 TTGCCCGT ./bowtie-build --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:2 MD:Z:3C0C3 NM:i:2 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Checking edits 1 (fw:0, sam:1) References: >0 TTGCCCGT ./bowtie -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:2 MD:Z:3C0C3 NM:i:2 XM:i:1 Checking edits 1 (fw:1, sam:1) References: >0 TTGCCCGT ./bowtie-build --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:2 MD:Z:3C0C3 NM:i:2 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Checking edits 1 (fw:0, sam:1) References: >0 TTGCCCGT ./bowtie -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:2 MD:Z:3C0C3 NM:i:2 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Checking edits 2 (fw:1, sam:1) References: >0 TTGTTCGT ./bowtie-build --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 1 255 8M * 0 0 TTGCCCGT IIIIIIII XA:i:2 MD:Z:3T0T3 NM:i:2 XM:i:1 Checking edits 2 (fw:0, sam:1) References: >0 TTGTTCGT ./bowtie -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 1 255 8M * 0 0 TTGCCCGT IIIIIIII XA:i:2 MD:Z:3T0T3 NM:i:2 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Checking edits 2 (fw:1, sam:1) References: >0 TTGTTCGT ./bowtie-build --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 1 255 8M * 0 0 TTGCCCGT IIIIIIII XA:i:2 MD:Z:3T0T3 NM:i:2 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Checking edits 2 (fw:0, sam:1) References: >0 TTGTTCGT ./bowtie -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 1 255 8M * 0 0 TTGCCCGT IIIIIIII XA:i:2 MD:Z:3T0T3 NM:i:2 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Checking edits 3 (fw:1, sam:1) References: >0 ACGTTCGT ./bowtie-build --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie -v 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 3 255 4M * 0 0 GTTC IIII XA:i:0 MD:Z:4 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Checking edits 3 (fw:0, sam:1) References: >0 ACGTTCGT ./bowtie -v 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 3 255 4M * 0 0 GTTC IIII XA:i:0 MD:Z:4 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Checking edits 3 (fw:1, sam:1) References: >0 ACGTTCGT ./bowtie-build --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie -n 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 3 255 4M * 0 0 GTTC IIII XA:i:0 MD:Z:4 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Checking edits 3 (fw:0, sam:1) References: >0 ACGTTCGT ./bowtie -n 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 3 255 4M * 0 0 GTTC IIII XA:i:0 MD:Z:4 NM:i:0 XM:i:1 FASTA-continuous 1 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie-build --large-index --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug --large-index -F 10,9 -S --quiet -a .simple_tests.tmp .simple_tests Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -F 10,9 -S --quiet -a .simple_tests.tmp .simple_tests" seq1_0 0 0 1 255 10M * 0 0 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 seq1_9 0 0 10 255 10M * 0 0 CAGTATCTGA IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 # reads processed: 2 # reads with at least one alignment: 2 (100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments FASTA-continuous 2 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug --large-index -F 10,9 -S --quiet -a .simple_tests.tmp .simple_tests Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -F 10,9 -S --quiet -a .simple_tests.tmp .simple_tests" seq1_0 0 0 1 255 10M * 0 0 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 seq2_0 0 0 1 255 10M * 0 0 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 # reads processed: 3 # reads with at least one alignment: 3 (100.00%) # reads that failed to align: 0 (0.00%) Reported 3 alignments seq2_9 0 0 10 255 10M * 0 0 CAGTATCTGA IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 FASTA-continuous 3 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug --large-index -F 10,9 -u 1 -S --quiet -a .simple_tests.tmp .simple_tests Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -F 10,9 -u 1 -S --quiet -a .simple_tests.tmp .simple_tests" seq1_0 0 0 1 255 10M * 0 0 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 FASTA-continuous 4 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug --large-index -F 10,9 -s 1 -S --quiet -a .simple_tests.tmp .simple_tests Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -F 10,9 -s 1 -S --quiet -a .simple_tests.tmp .simple_tests" seq1_9 0 0 10 255 10M * 0 0 CAGTATCTGA IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments FASTA-continuous 5 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug --large-index -F 10,9 -u 1 -s 1 -S --quiet -a .simple_tests.tmp .simple_tests Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -F 10,9 -u 1 -s 1 -S --quiet -a .simple_tests.tmp .simple_tests" seq2_0 0 0 1 255 10M * 0 0 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 FASTA-continuous 6 (fw:1, sam:1) References: >0 AGCATCGATCAG ./bowtie-build --large-index --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug --large-index -F 10,1 -S --quiet -a .simple_tests.tmp .simple_tests Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted # reads processed: 3 # reads with at least one alignment: 3 (100.00%) # reads that failed to align: 0 (0.00%) Reported 3 alignments @SQ SN:0 LN:12 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -F 10,1 -S --quiet -a .simple_tests.tmp .simple_tests" seq1_0 0 0 1 255 10M * 0 0 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 seq1_1 0 0 2 255 10M * 0 0 GCATCGATCA IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 seq1_2 0 0 3 255 10M * 0 0 CATCGATCAG IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 Cline 7 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie-build --large-index --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug --large-index --trim3 4 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 --trim3 4 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII" 0 0 0 3 255 12M * 0 0 CATCGATCAGTA IIIIIIIIIIII XA:i:0 MD:Z:12 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Cline 8 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug --large-index --trim5 16 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 --trim5 16 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII" 0 4 * 0 0 * * 0 0 XM:i:0 # reads processed: 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments Cline 9 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug --large-index -s 1 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII" # reads processed: 0 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 0 (0.00%) No alignments Cline multiread 2 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug --large-index -u 1 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII,ATCGATCAGTATCTG:IIIIIIIIIIIIIII Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII,ATCGATCAGTATCTG:IIIIIIIIIIIIIII" 0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Cline multiread 3 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug --large-index -u 2 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG,ATCGATCAGTATCTG Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 2 # reads with at least one alignment: 2 (100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -u 2 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG,ATCGATCAGTATCTG" 0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 1 0 0 4 255 15M * 0 0 ATCGATCAGTATCTG IIIIIIIIIIIIIII XA:i:0 MD:Z:15 NM:i:0 XM:i:1 Cline paired 2 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie-build --large-index --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug --large-index -s 1 -S --quiet -a .simple_tests.tmp -c -1 AGCATCGATC:IIIIIIIIII,TCAGTTTTTGA:IIIIIIIIIII -2 TCAGTTTTTGA:IIIIIIIIIII,AGCATCGATC:IIIIIIIIII Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -c -1 AGCATCGATC:IIIIIIIIII,TCAGTTTTTGA:IIIIIIIIIII -2 TCAGTTTTTGA:IIIIIIIIIII,AGCATCGATC:IIIIIIIIII" 1 163 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 1 83 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 Cline paired 3 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --debug --large-index -u 1 -S --quiet -a .simple_tests.tmp -c -1 AGCATCGATC:IIIIIIIIII,TCAGTTTTTGA:IIIIIIIIIII -2 TCAGTTTTTGA:IIIIIIIIIII,AGCATCGATC:IIIIIIIIII Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -c -1 AGCATCGATC:IIIIIIIIII,TCAGTTTTTGA:IIIIIIIIIII -2 TCAGTTTTTGA:IIIIIIIIIII,AGCATCGATC:IIIIIIIIII" 0 99 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 0 147 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 Cline paired 4 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --debug --large-index -3 7 -S --quiet -a .simple_tests.tmp -c -1 AGCATCG:IIIIIII -2 GATCAAAAACTGA:IIIIIIIIIIIII Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -3 7 -S --quiet -a .simple_tests.tmp -c -1 AGCATCG:IIIIIII -2 GATCAAAAACTGA:IIIIIIIIIIIII" 0 77 * 0 0 * * 0 0 XM:i:0 0 141 * 0 0 * * 0 0 GATCAA IIIIII XM:i:0 Fastq 7 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie-build --large-index --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug --large-index --trim3 4 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 --trim3 4 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq" r0 0 0 3 255 12M * 0 0 CATCGATCAGTA IIIIIIIIIIII XA:i:0 MD:Z:12 NM:i:0 XM:i:1 Fastq 8 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug --large-index --trim5 16 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 --trim5 16 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq" r0 4 * 0 0 * * 0 0 XM:i:0 Fastq 9 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug --large-index -s 1 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq" # reads processed: 0 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 0 (0.00%) No alignments Fastq multiread 2 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug --large-index -u 1 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq" r0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Fastq multiread 3 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug --large-index -u 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -u 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq" r0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 # reads processed: 2 # reads with at least one alignment: 2 (100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments r1 0 0 4 255 15M * 0 0 ATCGATCAGTATCTG IIIIIIIIIIIIIII XA:i:0 MD:Z:15 NM:i:0 XM:i:1 Fastq paired 2 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie-build --large-index --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug --large-index -s 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r1 163 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 r1 83 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 Fastq paired 3 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --debug --large-index -u 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 r0 147 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Fastq paired 4 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --debug --large-index -3 7 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -3 7 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 77 * 0 0 * * 0 0 XM:i:0 r0 141 * 0 0 * * 0 0 GATCAA IIIIII XM:i:0 # reads processed: 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments Fasta 7 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie-build --large-index --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug --large-index --trim3 4 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 --trim3 4 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa" r0 0 0 3 255 12M * 0 0 CATCGATCAGTA IIIIIIIIIIII XA:i:0 MD:Z:12 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Fasta 8 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug --large-index --trim3 16 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 --trim3 16 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa" r0 4 * 0 0 * * 0 0 XM:i:0 # reads processed: 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments Fasta 9 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug --large-index -s 1 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 0 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 0 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa" 0.00%) No alignments Fasta multiread 2 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug --large-index -u 1 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa" r0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 Fasta multiread 3 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug --large-index -u 2 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 2 # reads with at least one alignment: 2 (100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -u 2 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa" r0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 r1 0 0 4 255 15M * 0 0 ATCGATCAGTATCTG IIIIIIIIIIIIIII XA:i:0 MD:Z:15 NM:i:0 XM:i:1 Fasta paired 2 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie-build --large-index --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug --large-index -s 1 -S --quiet -a .simple_tests.tmp -f -1 .simple_tests.1.fa -2 .simple_tests.2.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -f -1 .simple_tests.1.fa -2 .simple_tests.2.fa" r1 163 0 1 255 9M = 9 19 AGCATCGAT IIIIIIIII XA:i:0 MD:Z:9 NM:i:0 XM:i:1 r1 83 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 Fasta paired 3 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --debug --large-index -u 1 -S --quiet -a .simple_tests.tmp -f -1 .simple_tests.1.fa -2 .simple_tests.2.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -f -1 .simple_tests.1.fa -2 .simple_tests.2.fa" r0 99 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 r0 147 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Fasta paired 4 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --debug --large-index -3 7 -S --quiet -a .simple_tests.tmp -f -1 .simple_tests.1.fa -2 .simple_tests.2.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -3 7 -S --quiet -a .simple_tests.tmp -f -1 .simple_tests.1.fa -2 .simple_tests.2.fa" 0 77 * 0 0 * * 0 0 XM:i:0 0 141 * 0 0 * * 0 0 GATCAA IIIIII XM:i:0 # reads processed: 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments Raw 7 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie-build --large-index --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug --large-index --trim3 4 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 --trim3 4 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw" 0 0 0 3 255 12M * 0 0 CATCGATCAGTA IIIIIIIIIIII XA:i:0 MD:Z:12 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Raw 8 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug --large-index --trim3 16 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 --trim3 16 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw" 0 4 * 0 0 * * 0 0 XM:i:0 Raw 9 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug --large-index -s 1 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw" # reads processed: 0 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 0 (0.00%) No alignments Raw multiread 2 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug --large-index -u 1 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw" 0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 Raw multiread 3 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug --large-index -u 2 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -u 2 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw" 0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 1 0 0 4 255 15M * 0 0 ATCGATCAGTATCTG IIIIIIIIIIIIIII XA:i:0 MD:Z:15 NM:i:0 XM:i:1 # reads processed: 2 # reads with at least one alignment: 2 (100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments Raw paired 2 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie-build --large-index --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug --large-index -s 1 -S --quiet -a .simple_tests.tmp -r -1 .simple_tests.1.raw -2 .simple_tests.2.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -r -1 .simple_tests.1.raw -2 .simple_tests.2.raw" 1 163 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 1 83 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 Raw paired 3 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --debug --large-index -u 1 -S --quiet -a .simple_tests.tmp -r -1 .simple_tests.1.raw -2 .simple_tests.2.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -r -1 .simple_tests.1.raw -2 .simple_tests.2.raw" 0 99 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 0 147 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 Raw paired 4 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --debug --large-index -3 7 -S --quiet -a .simple_tests.tmp -r -1 .simple_tests.1.raw -2 .simple_tests.2.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -3 7 -S --quiet -a .simple_tests.tmp -r -1 .simple_tests.1.raw -2 .simple_tests.2.raw" 0 77 * 0 0 * * 0 0 XM:i:0 0 141 * 0 0 * * 0 0 GATCAA IIIIII XM:i:0 # reads processed: 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments Tabbed 7 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie-build --large-index --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug --large-index --trim3 4 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 --trim3 4 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r0 0 0 3 255 12M * 0 0 CATCGATCAGTA IIIIIIIIIIII XA:i:0 MD:Z:12 NM:i:0 XM:i:1 Tabbed 8 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug --large-index --trim5 16 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 --trim5 16 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r0 4 * 0 0 * * 0 0 XM:i:0 Tabbed 9 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug --large-index -s 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 0 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 0 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" 0.00%) No alignments Tabbed multiread 2 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug --large-index -u 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Tabbed multiread 3 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug --large-index -u 2 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -u 2 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 r1 0 0 4 255 15M * 0 0 ATCGATCAGTATCTG IIIIIIIIIIIIIII XA:i:0 MD:Z:15 NM:i:0 XM:i:1 # reads processed: 2 # reads with at least one alignment: 2 (100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments Tabbed paired 2 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie-build --large-index --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug --large-index -s 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r1 163 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 r1 83 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 Tabbed paired 3 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --debug --large-index -u 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r0 99 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 r0 147 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Tabbed paired 4 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --debug --large-index -3 7 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -3 7 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r0 77 * 0 0 * * 0 0 XM:i:0 r0 141 * 0 0 * * 0 0 GATCAA IIIIII XM:i:0 Interleaved 1 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie-build --large-index --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug --large-index -v 0 -S --quiet -a .simple_tests.tmp --interleaved .simple_tests.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp --interleaved .simple_tests.fq" r0 99 0 3 255 8M = 17 21 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 17 255 7M = 3 -21 TAGATGG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 1 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 17 21 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 17 255 7M = 3 -21 TAGATGG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 Paired-end 1 (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 17 21 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 17 255 7M = 3 -21 TAGATGG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 Paired-end 1 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 17 21 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 17 255 7M = 3 -21 TAGATGG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 Paired-end 1 (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 17 21 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 17 255 7M = 3 -21 TAGATGG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 Paired-end 2 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 12 16 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 12 255 7M = 3 -16 TTTTATA IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 Paired-end 2 (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 12 16 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 12 255 7M = 3 -16 TTTTATA IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 2 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 12 16 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 12 255 7M = 3 -16 TTTTATA IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 2 (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 12 16 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 12 255 7M = 3 -16 TTTTATA IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 3 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 8 12 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 8 255 7M = 3 -12 AAGCTTT IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 3 (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 8 12 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 8 255 7M = 3 -12 AAGCTTT IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 3 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 8 12 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 8 255 7M = 3 -12 AAGCTTT IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 3 (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 8 12 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 8 255 7M = 3 -12 AAGCTTT IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 Paired-end 4, containment excluded (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 77 * 0 0 * * 0 0 AACGAAAG IIIIIIII XM:i:0 r0 141 * 0 0 * * 0 0 CTTTCGT IIIIIII XM:i:0 # reads processed: 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments Paired-end 4, containment excluded (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 77 * 0 0 * * 0 0 CTTTCGT IIIIIII XM:i:0 r0 141 * 0 0 * * 0 0 AACGAAAG IIIIIIII XM:i:0 # reads processed: 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments Paired-end 4, containment excluded (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 77 * 0 0 * * 0 0 AACGAAAG IIIIIIII XM:i:0 r0 141 * 0 0 * * 0 0 CTTTCGT IIIIIII XM:i:0 Paired-end 4, containment excluded (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 77 * 0 0 * * 0 0 CTTTCGT IIIIIII XM:i:0 r0 141 * 0 0 * * 0 0 AACGAAAG IIIIIIII XM:i:0 # reads processed: 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments Paired-end 5, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 4 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 4 255 7M = 3 -8 ACGAAAG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 5, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 4 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 4 255 7M = 3 -8 ACGAAAG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 5, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 4 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 4 255 7M = 3 -8 ACGAAAG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 Paired-end 5, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 4 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments r0 83 0 4 255 7M = 3 -8 ACGAAAG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 Paired-end 6, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 6, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 6, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 Paired-end 6, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 7, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index --allow-contain -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 --allow-contain -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 0.00%) Reported 1 paired-end alignments Paired-end 7, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index --allow-contain -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 --allow-contain -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 Paired-end 7, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index --allow-contain -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 --allow-contain -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 Paired-end 7, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index --allow-contain -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 --allow-contain -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 Paired-end 8, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index --allow-contain --ff -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 --allow-contain --ff -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 131 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 Paired-end 8, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index --allow-contain --ff -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 --allow-contain --ff -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 131 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 8, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index --allow-contain --ff -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 --allow-contain --ff -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 131 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 Paired-end 8, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index --allow-contain --ff -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 --allow-contain --ff -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 131 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 Paired-end 9, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index --allow-contain --ff -v 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 --allow-contain --ff -v 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 131 0 3 255 8M = 3 8 AACGATAG IIIIIIII XA:i:1 MD:Z:5A2 NM:i:1 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 9, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index --allow-contain --ff -v 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 --allow-contain --ff -v 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGATAG IIIIIIII XA:i:1 MD:Z:5A2 NM:i:1 XM:i:1 r0 131 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 Paired-end 9, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index --allow-contain --ff -n 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 --allow-contain --ff -n 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 131 0 3 255 8M = 3 8 AACGATAG IIIIIIII XA:i:1 MD:Z:5A2 NM:i:1 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 9, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index --allow-contain --ff -n 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 --allow-contain --ff -n 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGATAG IIIIIIII XA:i:1 MD:Z:5A2 NM:i:1 XM:i:1 r0 131 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 Checking -m, 1 (fw:1, sam:1) References: >0 TTGTTCGTTTGTTCGT ./bowtie-build --large-index --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug --large-index -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:16 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 9 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 0 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 0.00%) Reported 2 alignments Checking -m, 1 (fw:0, sam:1) References: >0 TTGTTCGTTTGTTCGT ./bowtie --debug --large-index -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:16 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 16 0 9 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 Checking -m, 1 (fw:1, sam:1) References: >0 TTGTTCGTTTGTTCGT ./bowtie-build --large-index --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug --large-index -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:16 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 9 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 0 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 Checking -m, 1 (fw:0, sam:1) References: >0 TTGTTCGTTTGTTCGT ./bowtie --debug --large-index -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:16 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 16 0 9 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 Checking -m, 2 (fw:1, sam:1) References: >0 TTGTTCGTTTGTTCGTTTGTTCGT ./bowtie-build --large-index --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug --large-index -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:24 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" 0.00%) # reads with alignments suppressed due to -m: 1 (100.00%) No alignments Checking -m, 2 (fw:0, sam:1) References: >0 TTGTTCGTTTGTTCGTTTGTTCGT ./bowtie --debug --large-index -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) # reads with alignments suppressed due to -m: 1 (100.00%) No alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:24 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" Checking -m, 2 (fw:1, sam:1) References: >0 TTGTTCGTTTGTTCGTTTGTTCGT ./bowtie-build --large-index --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug --large-index -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) # reads with alignments suppressed due to -m: 1 (100.00%) No alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:24 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" Checking -m, 2 (fw:0, sam:1) References: >0 TTGTTCGTTTGTTCGTTTGTTCGT ./bowtie --debug --large-index -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:24 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) # reads with alignments suppressed due to -m: 1 (100.00%) No alignments Checking edits 1 (fw:1, sam:1) References: >0 TTGCCCGT ./bowtie-build --large-index --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug --large-index -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:2 MD:Z:3C0C3 NM:i:2 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Checking edits 1 (fw:0, sam:1) References: >0 TTGCCCGT ./bowtie --debug --large-index -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:2 MD:Z:3C0C3 NM:i:2 XM:i:1 Checking edits 1 (fw:1, sam:1) References: >0 TTGCCCGT ./bowtie-build --large-index --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug --large-index -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:2 MD:Z:3C0C3 NM:i:2 XM:i:1 Checking edits 1 (fw:0, sam:1) References: >0 TTGCCCGT ./bowtie --debug --large-index -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:2 MD:Z:3C0C3 NM:i:2 XM:i:1 Checking edits 2 (fw:1, sam:1) References: >0 TTGTTCGT ./bowtie-build --large-index --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug --large-index -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 1 255 8M * 0 0 TTGCCCGT IIIIIIII XA:i:2 MD:Z:3T0T3 NM:i:2 XM:i:1 Checking edits 2 (fw:0, sam:1) References: >0 TTGTTCGT ./bowtie --debug --large-index -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 1 255 8M * 0 0 TTGCCCGT IIIIIIII XA:i:2 MD:Z:3T0T3 NM:i:2 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Checking edits 2 (fw:1, sam:1) References: >0 TTGTTCGT ./bowtie-build --large-index --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug --large-index -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 1 255 8M * 0 0 TTGCCCGT IIIIIIII XA:i:2 MD:Z:3T0T3 NM:i:2 XM:i:1 Checking edits 2 (fw:0, sam:1) References: >0 TTGTTCGT ./bowtie --debug --large-index -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 1 255 8M * 0 0 TTGCCCGT IIIIIIII XA:i:2 MD:Z:3T0T3 NM:i:2 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Checking edits 3 (fw:1, sam:1) References: >0 ACGTTCGT ./bowtie-build --large-index --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug --large-index -v 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 3 255 4M * 0 0 GTTC IIII XA:i:0 MD:Z:4 NM:i:0 XM:i:1 Checking edits 3 (fw:0, sam:1) References: >0 ACGTTCGT ./bowtie --debug --large-index -v 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 3 255 4M * 0 0 GTTC IIII XA:i:0 MD:Z:4 NM:i:0 XM:i:1 Checking edits 3 (fw:1, sam:1) References: >0 ACGTTCGT ./bowtie-build --large-index --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug --large-index -n 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 3 255 4M * 0 0 GTTC IIII XA:i:0 MD:Z:4 NM:i:0 XM:i:1 Checking edits 3 (fw:0, sam:1) References: >0 ACGTTCGT ./bowtie --debug --large-index -n 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 3 255 4M * 0 0 GTTC IIII XA:i:0 MD:Z:4 NM:i:0 XM:i:1 FASTA-continuous 1 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie-build --large-index --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --large-index -F 10,9 -S --quiet -a .simple_tests.tmp .simple_tests Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -F 10,9 -S --quiet -a .simple_tests.tmp .simple_tests" seq1_0 0 0 1 255 10M * 0 0 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 # reads processed: 2 # reads with at least one alignment: 2 (100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments seq1_9 0 0 10 255 10M * 0 0 CAGTATCTGA IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 FASTA-continuous 2 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --large-index -F 10,9 -S --quiet -a .simple_tests.tmp .simple_tests Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -F 10,9 -S --quiet -a .simple_tests.tmp .simple_tests" seq1_0 0 0 1 255 10M * 0 0 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 seq2_0 0 0 1 255 10M * 0 0 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 seq2_9 0 0 10 255 10M * 0 0 CAGTATCTGA IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 # reads processed: 3 # reads with at least one alignment: 3 (100.00%) # reads that failed to align: 0 (0.00%) Reported 3 alignments FASTA-continuous 3 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --large-index -F 10,9 -u 1 -S --quiet -a .simple_tests.tmp .simple_tests Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -F 10,9 -u 1 -S --quiet -a .simple_tests.tmp .simple_tests" seq1_0 0 0 1 255 10M * 0 0 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments FASTA-continuous 4 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --large-index -F 10,9 -s 1 -S --quiet -a .simple_tests.tmp .simple_tests Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -F 10,9 -s 1 -S --quiet -a .simple_tests.tmp .simple_tests" seq1_9 0 0 10 255 10M * 0 0 CAGTATCTGA IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments FASTA-continuous 5 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --large-index -F 10,9 -u 1 -s 1 -S --quiet -a .simple_tests.tmp .simple_tests Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -F 10,9 -u 1 -s 1 -S --quiet -a .simple_tests.tmp .simple_tests" seq2_0 0 0 1 255 10M * 0 0 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments FASTA-continuous 6 (fw:1, sam:1) References: >0 AGCATCGATCAG ./bowtie-build --large-index --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --large-index -F 10,1 -S --quiet -a .simple_tests.tmp .simple_tests Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:12 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -F 10,1 -S --quiet -a .simple_tests.tmp .simple_tests" seq1_0 0 0 1 255 10M * 0 0 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 seq1_1 0 0 2 255 10M * 0 0 GCATCGATCA IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 seq1_2 0 0 3 255 10M * 0 0 CATCGATCAG IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 # reads processed: 3 # reads with at least one alignment: 3 (100.00%) # reads that failed to align: 0 (0.00%) Reported 3 alignments Cline 7 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie-build --large-index --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --large-index --trim3 4 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 --trim3 4 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII" 0 0 0 3 255 12M * 0 0 CATCGATCAGTA IIIIIIIIIIII XA:i:0 MD:Z:12 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Cline 8 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --large-index --trim5 16 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 --trim5 16 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII" 0 4 * 0 0 * * 0 0 XM:i:0 # reads processed: 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments Cline 9 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --large-index -s 1 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 0 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 0 (0.00%) No alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII" Cline multiread 2 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --large-index -u 1 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII,ATCGATCAGTATCTG:IIIIIIIIIIIIIII Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII,ATCGATCAGTATCTG:IIIIIIIIIIIIIII" 0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Cline multiread 3 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --large-index -u 2 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG,ATCGATCAGTATCTG Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 # reads processed: 2 # reads with at least one alignment: 2 (100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -u 2 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG,ATCGATCAGTATCTG" 0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 1 0 0 4 255 15M * 0 0 ATCGATCAGTATCTG IIIIIIIIIIIIIII XA:i:0 MD:Z:15 NM:i:0 XM:i:1 Cline paired 2 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie-build --large-index --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --large-index -s 1 -S --quiet -a .simple_tests.tmp -c -1 AGCATCGATC:IIIIIIIIII,TCAGTTTTTGA:IIIIIIIIIII -2 TCAGTTTTTGA:IIIIIIIIIII,AGCATCGATC:IIIIIIIIII Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -c -1 AGCATCGATC:IIIIIIIIII,TCAGTTTTTGA:IIIIIIIIIII -2 TCAGTTTTTGA:IIIIIIIIIII,AGCATCGATC:IIIIIIIIII" 1 163 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 1 83 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 Cline paired 3 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --large-index -u 1 -S --quiet -a .simple_tests.tmp -c -1 AGCATCGATC:IIIIIIIIII,TCAGTTTTTGA:IIIIIIIIIII -2 TCAGTTTTTGA:IIIIIIIIIII,AGCATCGATC:IIIIIIIIII Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -c -1 AGCATCGATC:IIIIIIIIII,TCAGTTTTTGA:IIIIIIIIIII -2 TCAGTTTTTGA:IIIIIIIIIII,AGCATCGATC:IIIIIIIIII" 0 99 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 0 147 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 Cline paired 4 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --large-index -3 7 -S --quiet -a .simple_tests.tmp -c -1 AGCATCG:IIIIIII -2 GATCAAAAACTGA:IIIIIIIIIIIII Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -3 7 -S --quiet -a .simple_tests.tmp -c -1 AGCATCG:IIIIIII -2 GATCAAAAACTGA:IIIIIIIIIIIII" 0 77 * 0 0 * * 0 0 XM:i:0 0 141 * 0 0 * * 0 0 GATCAA IIIIII XM:i:0 Fastq 7 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie-build --large-index --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --large-index --trim3 4 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 --trim3 4 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq" r0 0 0 3 255 12M * 0 0 CATCGATCAGTA IIIIIIIIIIII XA:i:0 MD:Z:12 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Fastq 8 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --large-index --trim5 16 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 --trim5 16 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq" r0 4 * 0 0 * * 0 0 XM:i:0 # reads processed: 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments Fastq 9 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --large-index -s 1 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq" # reads processed: 0 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 0 (0.00%) No alignments Fastq multiread 2 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --large-index -u 1 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq" r0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Fastq multiread 3 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --large-index -u 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -u 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq" r0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 r1 0 0 4 255 15M * 0 0 ATCGATCAGTATCTG IIIIIIIIIIIIIII XA:i:0 MD:Z:15 NM:i:0 XM:i:1 # reads processed: 2 # reads with at least one alignment: 2 (100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments Fastq paired 2 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie-build --large-index --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --large-index -s 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r1 163 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 r1 83 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 Fastq paired 3 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --large-index -u 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 r0 147 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 Fastq paired 4 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --large-index -3 7 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -3 7 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" # reads processed: 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments r0 77 * 0 0 * * 0 0 XM:i:0 r0 141 * 0 0 * * 0 0 GATCAA IIIIII XM:i:0 Fasta 7 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie-build --large-index --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --large-index --trim3 4 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 --trim3 4 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa" r0 0 0 3 255 12M * 0 0 CATCGATCAGTA IIIIIIIIIIII XA:i:0 MD:Z:12 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Fasta 8 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --large-index --trim3 16 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 --trim3 16 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa" r0 4 * 0 0 * * 0 0 XM:i:0 Fasta 9 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --large-index -s 1 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa" # reads processed: 0 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 0 (0.00%) No alignments Fasta multiread 2 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --large-index -u 1 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa" r0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Fasta multiread 3 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --large-index -u 2 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -u 2 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa" r0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 # reads processed: 2 # reads with at least one alignment: 2 (100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments r1 0 0 4 255 15M * 0 0 ATCGATCAGTATCTG IIIIIIIIIIIIIII XA:i:0 MD:Z:15 NM:i:0 XM:i:1 Fasta paired 2 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie-build --large-index --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --large-index -s 1 -S --quiet -a .simple_tests.tmp -f -1 .simple_tests.1.fa -2 .simple_tests.2.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -f -1 .simple_tests.1.fa -2 .simple_tests.2.fa" r1 163 0 1 255 9M = 9 19 AGCATCGAT IIIIIIIII XA:i:0 MD:Z:9 NM:i:0 XM:i:1 r1 83 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Fasta paired 3 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --large-index -u 1 -S --quiet -a .simple_tests.tmp -f -1 .simple_tests.1.fa -2 .simple_tests.2.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -f -1 .simple_tests.1.fa -2 .simple_tests.2.fa" r0 99 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 r0 147 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Fasta paired 4 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --large-index -3 7 -S --quiet -a .simple_tests.tmp -f -1 .simple_tests.1.fa -2 .simple_tests.2.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -3 7 -S --quiet -a .simple_tests.tmp -f -1 .simple_tests.1.fa -2 .simple_tests.2.fa" 0 77 * 0 0 * * 0 0 XM:i:0 0 141 * 0 0 * * 0 0 GATCAA IIIIII XM:i:0 Raw 7 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie-build --large-index --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --large-index --trim3 4 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 --trim3 4 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw" 0 0 0 3 255 12M * 0 0 CATCGATCAGTA IIIIIIIIIIII XA:i:0 MD:Z:12 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Raw 8 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --large-index --trim3 16 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 --trim3 16 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw" 0 4 * 0 0 * * 0 0 XM:i:0 Raw 9 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --large-index -s 1 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw" # reads processed: 0 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 0 (0.00%) No alignments Raw multiread 2 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --large-index -u 1 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw" 0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Raw multiread 3 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --large-index -u 2 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -u 2 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw" 0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 1 0 0 4 255 15M * 0 0 ATCGATCAGTATCTG IIIIIIIIIIIIIII XA:i:0 MD:Z:15 NM:i:0 XM:i:1 # reads processed: 2 # reads with at least one alignment: 2 (100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments Raw paired 2 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie-build --large-index --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --large-index -s 1 -S --quiet -a .simple_tests.tmp -r -1 .simple_tests.1.raw -2 .simple_tests.2.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -r -1 .simple_tests.1.raw -2 .simple_tests.2.raw" 1 163 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 1 83 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 Raw paired 3 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --large-index -u 1 -S --quiet -a .simple_tests.tmp -r -1 .simple_tests.1.raw -2 .simple_tests.2.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -r -1 .simple_tests.1.raw -2 .simple_tests.2.raw" 0 99 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 0 147 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 Raw paired 4 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --large-index -3 7 -S --quiet -a .simple_tests.tmp -r -1 .simple_tests.1.raw -2 .simple_tests.2.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -3 7 -S --quiet -a .simple_tests.tmp -r -1 .simple_tests.1.raw -2 .simple_tests.2.raw" 0 77 * 0 0 * * 0 0 XM:i:0 0 141 * 0 0 * * 0 0 GATCAA IIIIII XM:i:0 # reads processed: 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments Tabbed 7 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie-build --large-index --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --large-index --trim3 4 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 --trim3 4 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r0 0 0 3 255 12M * 0 0 CATCGATCAGTA IIIIIIIIIIII XA:i:0 MD:Z:12 NM:i:0 XM:i:1 0.00%) Reported 1 alignments Tabbed 8 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --large-index --trim5 16 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 --trim5 16 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r0 4 * 0 0 * * 0 0 XM:i:0 # reads processed: 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments Tabbed 9 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --large-index -s 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" # reads processed: 0 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 0 (0.00%) No alignments Tabbed multiread 2 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --large-index -u 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 Tabbed multiread 3 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --large-index -u 2 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -u 2 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 r1 0 0 4 255 15M * 0 0 ATCGATCAGTATCTG IIIIIIIIIIIIIII XA:i:0 MD:Z:15 NM:i:0 XM:i:1 # reads processed: 2 # reads with at least one alignment: 2 (100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments Tabbed paired 2 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie-build --large-index --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --large-index -s 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r1 163 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 r1 83 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 Tabbed paired 3 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --large-index -u 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r0 99 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 r0 147 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Tabbed paired 4 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --large-index -3 7 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -3 7 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r0 77 * 0 0 * * 0 0 XM:i:0 r0 141 * 0 0 * * 0 0 GATCAA IIIIII XM:i:0 # reads processed: 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments Interleaved 1 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie-build --large-index --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --large-index -v 0 -S --quiet -a .simple_tests.tmp --interleaved .simple_tests.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp --interleaved .simple_tests.fq" r0 99 0 3 255 8M = 17 21 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 17 255 7M = 3 -21 TAGATGG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 1 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 17 21 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 17 255 7M = 3 -21 TAGATGG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 Paired-end 1 (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 17 21 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 17 255 7M = 3 -21 TAGATGG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 1 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 17 21 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 17 255 7M = 3 -21 TAGATGG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 1 (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 17 21 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 17 255 7M = 3 -21 TAGATGG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 2 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 12 16 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 12 255 7M = 3 -16 TTTTATA IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 Paired-end 2 (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 12 16 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 12 255 7M = 3 -16 TTTTATA IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 Paired-end 2 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 12 16 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 12 255 7M = 3 -16 TTTTATA IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 2 (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 12 16 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 12 255 7M = 3 -16 TTTTATA IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 3 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 8 12 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 8 255 7M = 3 -12 AAGCTTT IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 3 (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 8 12 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 8 255 7M = 3 -12 AAGCTTT IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 3 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 8 12 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 8 255 7M = 3 -12 AAGCTTT IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 3 (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 8 12 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 8 255 7M = 3 -12 AAGCTTT IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 4, containment excluded (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 77 * 0 0 * * 0 0 AACGAAAG IIIIIIII XM:i:0 r0 141 * 0 0 * * 0 0 CTTTCGT IIIIIII XM:i:0 # reads processed: 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments Paired-end 4, containment excluded (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 77 * 0 0 * * 0 0 CTTTCGT IIIIIII XM:i:0 r0 141 * 0 0 * * 0 0 AACGAAAG IIIIIIII XM:i:0 # reads processed: 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments Paired-end 4, containment excluded (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 77 * 0 0 * * 0 0 AACGAAAG IIIIIIII XM:i:0 r0 141 * 0 0 * * 0 0 CTTTCGT IIIIIII XM:i:0 Paired-end 4, containment excluded (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 77 * 0 0 * * 0 0 CTTTCGT IIIIIII XM:i:0 r0 141 * 0 0 * * 0 0 AACGAAAG IIIIIIII XM:i:0 Paired-end 5, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 4 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 4 255 7M = 3 -8 ACGAAAG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 5, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 4 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 4 255 7M = 3 -8 ACGAAAG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 5, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 4 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 4 255 7M = 3 -8 ACGAAAG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 5, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 4 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 4 255 7M = 3 -8 ACGAAAG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 6, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 6, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 Paired-end 6, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 6, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 Paired-end 7, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index --allow-contain -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 --allow-contain -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments r0 99 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 Paired-end 7, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index --allow-contain -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted 1 @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 --allow-contain -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 7, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index --allow-contain -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 --allow-contain -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments r0 147 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 Paired-end 7, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index --allow-contain -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 --allow-contain -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 8, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index --allow-contain --ff -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 --allow-contain --ff -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments r0 131 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 Paired-end 8, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index --allow-contain --ff -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 --allow-contain --ff -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 131 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 8, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index --allow-contain --ff -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 --allow-contain --ff -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 131 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 Paired-end 8, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index --allow-contain --ff -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 --allow-contain --ff -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 131 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 9, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index --allow-contain --ff -v 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 --allow-contain --ff -v 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 131 0 3 255 8M = 3 8 AACGATAG IIIIIIII XA:i:1 MD:Z:5A2 NM:i:1 XM:i:1 (0.00%) Reported 1 paired-end alignments Paired-end 9, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index --allow-contain --ff -v 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 --allow-contain --ff -v 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGATAG IIIIIIII XA:i:1 MD:Z:5A2 NM:i:1 XM:i:1 r0 131 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 Paired-end 9, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index --allow-contain --ff -n 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 --allow-contain --ff -n 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 131 0 3 255 8M = 3 8 AACGATAG IIIIIIII XA:i:1 MD:Z:5A2 NM:i:1 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 9, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index --allow-contain --ff -n 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 --allow-contain --ff -n 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGATAG IIIIIIII XA:i:1 MD:Z:5A2 NM:i:1 XM:i:1 r0 131 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 0.00%) Reported 1 paired-end alignments Checking -m, 1 (fw:1, sam:1) References: >0 TTGTTCGTTTGTTCGT ./bowtie-build --large-index --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --large-index -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:16 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 9 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 0 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments Checking -m, 1 (fw:0, sam:1) References: >0 TTGTTCGTTTGTTCGT ./bowtie --large-index -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:16 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 16 0 9 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments Checking -m, 1 (fw:1, sam:1) References: >0 TTGTTCGTTTGTTCGT ./bowtie-build --large-index --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --large-index -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:16 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 9 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 0 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 Checking -m, 1 (fw:0, sam:1) References: >0 TTGTTCGTTTGTTCGT ./bowtie --large-index -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:16 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 16 0 9 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments Checking -m, 2 (fw:1, sam:1) References: >0 TTGTTCGTTTGTTCGTTTGTTCGT ./bowtie-build --large-index --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --large-index -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) # reads with alignments suppressed due to -m: 1 (100.00%) No alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:24 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" Checking -m, 2 (fw:0, sam:1) References: >0 TTGTTCGTTTGTTCGTTTGTTCGT ./bowtie --large-index -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) # reads with alignments suppressed due to -m: 1 (100.00%) No alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:24 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" Checking -m, 2 (fw:1, sam:1) References: >0 TTGTTCGTTTGTTCGTTTGTTCGT ./bowtie-build --large-index --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --large-index -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:24 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) # reads with alignments suppressed due to -m: 1 (100.00%) No alignments Checking -m, 2 (fw:0, sam:1) References: >0 TTGTTCGTTTGTTCGTTTGTTCGT ./bowtie --large-index -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) # reads with alignments suppressed due to -m: 1 (100.00%) No alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:24 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" Checking edits 1 (fw:1, sam:1) References: >0 TTGCCCGT ./bowtie-build --large-index --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --large-index -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:2 MD:Z:3C0C3 NM:i:2 XM:i:1 Checking edits 1 (fw:0, sam:1) References: >0 TTGCCCGT ./bowtie --large-index -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:2 MD:Z:3C0C3 NM:i:2 XM:i:1 Checking edits 1 (fw:1, sam:1) References: >0 TTGCCCGT ./bowtie-build --large-index --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --large-index -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:2 MD:Z:3C0C3 NM:i:2 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Checking edits 1 (fw:0, sam:1) References: >0 TTGCCCGT ./bowtie --large-index -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:2 MD:Z:3C0C3 NM:i:2 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Checking edits 2 (fw:1, sam:1) References: >0 TTGTTCGT ./bowtie-build --large-index --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --large-index -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 1 255 8M * 0 0 TTGCCCGT IIIIIIII XA:i:2 MD:Z:3T0T3 NM:i:2 XM:i:1 Checking edits 2 (fw:0, sam:1) References: >0 TTGTTCGT ./bowtie --large-index -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 1 255 8M * 0 0 TTGCCCGT IIIIIIII XA:i:2 MD:Z:3T0T3 NM:i:2 XM:i:1 Checking edits 2 (fw:1, sam:1) References: >0 TTGTTCGT ./bowtie-build --large-index --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --large-index -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 1 255 8M * 0 0 TTGCCCGT IIIIIIII XA:i:2 MD:Z:3T0T3 NM:i:2 XM:i:1 Checking edits 2 (fw:0, sam:1) References: >0 TTGTTCGT ./bowtie --large-index -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 1 255 8M * 0 0 TTGCCCGT IIIIIIII XA:i:2 MD:Z:3T0T3 NM:i:2 XM:i:1 Checking edits 3 (fw:1, sam:1) References: >0 ACGTTCGT ./bowtie-build --large-index --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --large-index -v 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 3 255 4M * 0 0 GTTC IIII XA:i:0 MD:Z:4 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Checking edits 3 (fw:0, sam:1) References: >0 ACGTTCGT ./bowtie --large-index -v 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 3 255 4M * 0 0 GTTC IIII XA:i:0 MD:Z:4 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Checking edits 3 (fw:1, sam:1) References: >0 ACGTTCGT ./bowtie-build --large-index --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --large-index -n 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 3 255 4M * 0 0 GTTC IIII XA:i:0 MD:Z:4 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Checking edits 3 (fw:0, sam:1) References: >0 ACGTTCGT ./bowtie --large-index -n 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments r0 16 0 3 255 4M * 0 0 GTTC IIII XA:i:0 MD:Z:4 NM:i:0 XM:i:1 PASSED + RPM_EC=0 ++ jobs -p + exit 0 Processing files: bowtie-1.3.1-3.fc40.riscv64 Executing(%doc): /bin/sh -e /var/tmp/rpm-tmp.1jDEUg + umask 022 + cd /builddir/build/BUILD + cd bowtie-1.3.1-src + DOCDIR=/builddir/build/BUILDROOT/bowtie-1.3.1-3.fc40.riscv64/usr/share/doc/bowtie + export LC_ALL= + LC_ALL= + export DOCDIR + /usr/bin/mkdir -p /builddir/build/BUILDROOT/bowtie-1.3.1-3.fc40.riscv64/usr/share/doc/bowtie + cp -pr /builddir/build/BUILD/bowtie-1.3.1-src/MANUAL /builddir/build/BUILDROOT/bowtie-1.3.1-3.fc40.riscv64/usr/share/doc/bowtie + cp -pr /builddir/build/BUILD/bowtie-1.3.1-src/NEWS /builddir/build/BUILDROOT/bowtie-1.3.1-3.fc40.riscv64/usr/share/doc/bowtie + cp -pr /builddir/build/BUILD/bowtie-1.3.1-src/VERSION /builddir/build/BUILDROOT/bowtie-1.3.1-3.fc40.riscv64/usr/share/doc/bowtie + cp -pr /builddir/build/BUILD/bowtie-1.3.1-src/AUTHORS /builddir/build/BUILDROOT/bowtie-1.3.1-3.fc40.riscv64/usr/share/doc/bowtie + cp -pr /builddir/build/BUILD/bowtie-1.3.1-src/TUTORIAL /builddir/build/BUILDROOT/bowtie-1.3.1-3.fc40.riscv64/usr/share/doc/bowtie + cp -pr /builddir/build/BUILD/bowtie-1.3.1-src/doc/manual.html /builddir/build/BUILDROOT/bowtie-1.3.1-3.fc40.riscv64/usr/share/doc/bowtie + cp -pr /builddir/build/BUILD/bowtie-1.3.1-src/doc/style.css /builddir/build/BUILDROOT/bowtie-1.3.1-3.fc40.riscv64/usr/share/doc/bowtie + RPM_EC=0 ++ jobs -p + exit 0 Executing(%license): /bin/sh -e /var/tmp/rpm-tmp.dim1wn + umask 022 + cd /builddir/build/BUILD + cd bowtie-1.3.1-src + LICENSEDIR=/builddir/build/BUILDROOT/bowtie-1.3.1-3.fc40.riscv64/usr/share/licenses/bowtie + export LC_ALL= + LC_ALL= + export LICENSEDIR + /usr/bin/mkdir -p /builddir/build/BUILDROOT/bowtie-1.3.1-3.fc40.riscv64/usr/share/licenses/bowtie + cp -pr /builddir/build/BUILD/bowtie-1.3.1-src/LICENSE /builddir/build/BUILDROOT/bowtie-1.3.1-3.fc40.riscv64/usr/share/licenses/bowtie + RPM_EC=0 ++ jobs -p + exit 0 Provides: bowtie = 1.3.1-3.fc40 bowtie(riscv-64) = 1.3.1-3.fc40 bundled(tiny-thread) = 1.1 Requires(rpmlib): rpmlib(CompressedFileNames) <= 3.0.4-1 rpmlib(FileDigests) <= 4.6.0-1 rpmlib(PayloadFilesHavePrefix) <= 4.0-1 Requires: /usr/bin/bash /usr/bin/perl /usr/bin/python3 /usr/bin/sh ld-linux-riscv64-lp64d.so.1()(64bit) ld-linux-riscv64-lp64d.so.1(GLIBC_2.27)(64bit) libc.so.6()(64bit) libc.so.6(GLIBC_2.27)(64bit) libc.so.6(GLIBC_2.32)(64bit) libc.so.6(GLIBC_2.33)(64bit) libc.so.6(GLIBC_2.34)(64bit) libc.so.6(GLIBC_2.38)(64bit) libgcc_s.so.1()(64bit) libgcc_s.so.1(GCC_3.0)(64bit) libgcc_s.so.1(GCC_3.4)(64bit) libm.so.6()(64bit) libm.so.6(GLIBC_2.27)(64bit) libstdc++.so.6()(64bit) libstdc++.so.6(CXXABI_1.3)(64bit) libstdc++.so.6(CXXABI_1.3.2)(64bit) libstdc++.so.6(CXXABI_1.3.8)(64bit) libstdc++.so.6(CXXABI_1.3.9)(64bit) libstdc++.so.6(GLIBCXX_3.4)(64bit) libstdc++.so.6(GLIBCXX_3.4.11)(64bit) libstdc++.so.6(GLIBCXX_3.4.20)(64bit) libstdc++.so.6(GLIBCXX_3.4.21)(64bit) libstdc++.so.6(GLIBCXX_3.4.22)(64bit) libstdc++.so.6(GLIBCXX_3.4.26)(64bit) libstdc++.so.6(GLIBCXX_3.4.30)(64bit) libstdc++.so.6(GLIBCXX_3.4.32)(64bit) libstdc++.so.6(GLIBCXX_3.4.9)(64bit) libz.so.1()(64bit) libz.so.1(ZLIB_1.2.0.2)(64bit) libz.so.1(ZLIB_1.2.3.3)(64bit) libz.so.1(ZLIB_1.2.3.5)(64bit) Processing files: bowtie-debugsource-1.3.1-3.fc40.riscv64 Provides: bowtie-debugsource = 1.3.1-3.fc40 bowtie-debugsource(riscv-64) = 1.3.1-3.fc40 Requires(rpmlib): rpmlib(CompressedFileNames) <= 3.0.4-1 rpmlib(FileDigests) <= 4.6.0-1 rpmlib(PayloadFilesHavePrefix) <= 4.0-1 Processing files: bowtie-debuginfo-1.3.1-3.fc40.riscv64 Provides: bowtie-debuginfo = 1.3.1-3.fc40 bowtie-debuginfo(riscv-64) = 1.3.1-3.fc40 debuginfo(build-id) = 10637bde19240d42ae396c2f678e33f79fec667c debuginfo(build-id) = 332af41705ea3c139668d8501c6fef1c093d6421 debuginfo(build-id) = 34351109cfc549a33dcdc2ecae155e7934eafdd5 debuginfo(build-id) = 4de73f81168f3c39b57e833ee9f97dc29dd60c80 debuginfo(build-id) = 55d300271788cb92771802470010b039fa3015d0 debuginfo(build-id) = 647de4a87897461626b1b1768c84de9d1623026d debuginfo(build-id) = 8cb29fd29e874c4302132480678067267145813e debuginfo(build-id) = 930af96e8af007148283dd0c1a2a4ffc5dc5fea3 debuginfo(build-id) = 97f846e6d3d93335ec9e4e3d0447fad0f031651a debuginfo(build-id) = 9c64cd3f03bb2786eddd578302e41893231abd23 debuginfo(build-id) = bde350f16a31275b776cc852deb45847a436bbb2 debuginfo(build-id) = de88b559b633b442f362bac127b5194889ace4e2 Requires(rpmlib): rpmlib(CompressedFileNames) <= 3.0.4-1 rpmlib(FileDigests) <= 4.6.0-1 rpmlib(PayloadFilesHavePrefix) <= 4.0-1 Recommends: bowtie-debugsource(riscv-64) = 1.3.1-3.fc40 Checking for unpackaged file(s): /usr/lib/rpm/check-files /builddir/build/BUILDROOT/bowtie-1.3.1-3.fc40.riscv64 Wrote: /builddir/build/RPMS/bowtie-debugsource-1.3.1-3.fc40.riscv64.rpm Wrote: /builddir/build/RPMS/bowtie-1.3.1-3.fc40.riscv64.rpm Wrote: /builddir/build/RPMS/bowtie-debuginfo-1.3.1-3.fc40.riscv64.rpm Child return code was: 0